Incidental Mutation 'R3083:Olfr102'
ID264081
Institutional Source Beutler Lab
Gene Symbol Olfr102
Ensembl Gene ENSMUSG00000091531
Gene Nameolfactory receptor 102
SynonymsMOR250-4, GA_x6K02T2PSCP-1775063-1774137
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37311795-37317054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37314195 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 63 (N63S)
Ref Sequence ENSEMBL: ENSMUSP00000149168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169373] [ENSMUST00000217590]
Predicted Effect probably damaging
Transcript: ENSMUST00000169373
AA Change: N63S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126737
Gene: ENSMUSG00000091531
AA Change: N63S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.6e-52 PFAM
Pfam:7tm_1 39 289 8.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217590
AA Change: N63S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Olfr102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr102 APN 17 37313707 missense possibly damaging 0.90
IGL01947:Olfr102 APN 17 37313665 missense probably damaging 1.00
IGL02164:Olfr102 APN 17 37313687 missense probably benign 0.01
IGL02465:Olfr102 APN 17 37313911 missense probably damaging 0.99
IGL03095:Olfr102 APN 17 37313773 missense probably benign 0.01
R0712:Olfr102 UTSW 17 37314084 missense probably damaging 0.96
R1572:Olfr102 UTSW 17 37313480 missense probably benign
R1749:Olfr102 UTSW 17 37314061 missense probably benign 0.05
R4022:Olfr102 UTSW 17 37314274 missense probably benign
R5203:Olfr102 UTSW 17 37314201 missense probably damaging 1.00
R5367:Olfr102 UTSW 17 37314256 missense probably damaging 1.00
R5387:Olfr102 UTSW 17 37314292 missense probably benign 0.22
R5488:Olfr102 UTSW 17 37313668 missense probably damaging 1.00
R6804:Olfr102 UTSW 17 37314130 missense probably damaging 1.00
R7442:Olfr102 UTSW 17 37313925 missense possibly damaging 0.89
R7473:Olfr102 UTSW 17 37313631 missense probably benign 0.03
R8110:Olfr102 UTSW 17 37313713 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCGGTCAAATGCCATCACTG -3'
(R):5'- ACTGGTTAACATGCAGGGTAG -3'

Sequencing Primer
(F):5'- ATCACTGGCAGCAGCATG -3'
(R):5'- GGTGATGTCTAATCAAACCTCAGTC -3'
Posted On2015-02-05