Mutagenetix > Incidental Mutations

Incidental Mutation 'R3083:Plcl2'

264082

Institutional Source

Beutler Lab

Gene Symbol

Plcl2

Ensembl Gene

ENSMUSG00000038910

Gene Name

phospholipase C-like 2

Synonyms

PRIP-2, Plce2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R3083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50509547-50688493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 50687744 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1080 (N1080K)

Ref Sequence

ENSEMBL: ENSMUSP00000046584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043938]

Predicted Effect

probably benign
Transcript: ENSMUST00000043938
AA Change: N1080K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: N1080K

Domain	Start	End	E-Value	Type
low complexity region	20	49	N/A	INTRINSIC
PH	143	254	2.88e-5	SMART
Pfam:EF-hand_like	344	426	3.7e-29	PFAM
PLCXc	427	571	2.19e-84	SMART
PLCYc	619	735	4.37e-61	SMART
C2	756	862	3.45e-19	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss3	A	G	10: 107,023,715	V341A	possibly damaging	Het
Armc2	T	C	10: 41,966,730	D359G	probably damaging	Het
Cdh6	T	C	15: 13,044,752	D428G	probably damaging	Het
Dennd4a	A	G	9: 64,906,081	N1441D	probably benign	Het
Fbln1	T	G	15: 85,265,253	I617S	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gm15446	A	G	5: 109,943,292	N470S	possibly damaging	Het
Grin3a	G	A	4: 49,665,243	R1131W	probably benign	Het
Hist3h2ba	A	G	11: 58,948,976	K13E	probably benign	Het
Incenp	T	A	19: 9,883,779	M480L	unknown	Het
Lrp1b	A	T	2: 40,600,324	M275K	probably damaging	Het
Lrrc14b	C	T	13: 74,363,218	D248N	possibly damaging	Het
Nlrp5	T	C	7: 23,430,163	F885S	probably benign	Het
Olfr102	T	C	17: 37,314,195	N63S	probably damaging	Het
Olfr1228	A	C	2: 89,249,001	V231G	probably damaging	Het
Olfr917	A	G	9: 38,665,616	V76A	probably damaging	Het
Rab3gap2	T	A	1: 185,204,269	S10T	probably benign	Het
Rtca	G	A	3: 116,508,025		probably benign	Het
Scn1a	A	G	2: 66,299,637	F1278S	probably damaging	Het
Slitrk3	T	C	3: 73,048,595	D948G	probably benign	Het
Smu1	T	C	4: 40,745,567	D251G	probably damaging	Het
Ssh3	C	T	19: 4,262,559	R586H	probably benign	Het
Tomm40l	A	T	1: 171,221,211	L78H	probably damaging	Het
Vmn2r4	A	G	3: 64,389,367	S666P	probably damaging	Het

Other mutations in Plcl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Plcl2	APN	17	50606920	missense	probably benign	0.01
IGL01746:Plcl2	APN	17	50607696	missense	probably benign	0.00
IGL02227:Plcl2	APN	17	50606397	missense	probably damaging	0.97
IGL02232:Plcl2	APN	17	50606641	missense	possibly damaging	0.66
IGL02878:Plcl2	APN	17	50607355	missense	probably damaging	1.00
IGL02985:Plcl2	APN	17	50687814	nonsense	probably null
Balsamic	UTSW	17	50607661	missense	probably damaging	1.00
Parece	UTSW	17	50607846	missense	probably damaging	0.99
picolinic	UTSW	17	50668160	splice site	probably null
verdad	UTSW	17	50608081	missense	probably damaging	1.00
BB007:Plcl2	UTSW	17	50606803	missense	probably benign
BB017:Plcl2	UTSW	17	50606803	missense	probably benign
IGL03014:Plcl2	UTSW	17	50611001	missense	possibly damaging	0.65
R0110:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0190:Plcl2	UTSW	17	50607643	missense	probably benign
R0280:Plcl2	UTSW	17	50607034	missense	probably damaging	1.00
R0414:Plcl2	UTSW	17	50607955	missense	possibly damaging	0.90
R0450:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0760:Plcl2	UTSW	17	50608774	missense	possibly damaging	0.82
R1134:Plcl2	UTSW	17	50608110	missense	probably benign
R1168:Plcl2	UTSW	17	50607072	missense	possibly damaging	0.49
R1381:Plcl2	UTSW	17	50607729	missense	probably damaging	0.99
R1748:Plcl2	UTSW	17	50606798	missense	probably benign
R1856:Plcl2	UTSW	17	50607850	missense	probably benign	0.13
R1958:Plcl2	UTSW	17	50608081	missense	probably damaging	1.00
R2016:Plcl2	UTSW	17	50606694	missense	probably damaging	1.00
R2057:Plcl2	UTSW	17	50668111	splice site	probably null
R2077:Plcl2	UTSW	17	50606829	missense	probably benign
R2247:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R4153:Plcl2	UTSW	17	50606361	nonsense	probably null
R4574:Plcl2	UTSW	17	50607846	missense	probably damaging	0.99
R4870:Plcl2	UTSW	17	50607226	missense	possibly damaging	0.46
R5030:Plcl2	UTSW	17	50607319	missense	possibly damaging	0.92
R5330:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5331:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5503:Plcl2	UTSW	17	50509929	missense	probably benign	0.00
R5920:Plcl2	UTSW	17	50608675	missense	probably damaging	0.99
R6238:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R6378:Plcl2	UTSW	17	50668160	splice site	probably null
R6603:Plcl2	UTSW	17	50607117	missense	probably benign	0.03
R6633:Plcl2	UTSW	17	50640140	missense	probably benign	0.00
R7113:Plcl2	UTSW	17	50606464	missense	probably damaging	1.00
R7466:Plcl2	UTSW	17	50608468	missense	probably damaging	1.00
R7665:Plcl2	UTSW	17	50607157	missense	probably benign	0.00
R7930:Plcl2	UTSW	17	50606803	missense	probably benign
R8114:Plcl2	UTSW	17	50687787	missense	probably damaging	0.97
R8152:Plcl2	UTSW	17	50607661	missense	probably damaging	1.00
R8208:Plcl2	UTSW	17	50608315	missense	probably damaging	1.00
X0026:Plcl2	UTSW	17	50607560	missense	probably benign	0.03
Z1088:Plcl2	UTSW	17	50606992	missense	probably damaging	1.00
Z1176:Plcl2	UTSW	17	50608456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATCGACCTCCTCGGATGTG -3'
(R):5'- CTCATCCTGATCAGTGAGCC -3'

Sequencing Primer
(F):5'- ACCTCCTCGGATGTGGTAAC -3'
(R):5'- ATCCTGATCAGTGAGCCAGTGC -3'

Posted On

2015-02-05