Incidental Mutation 'R3083:Ssh3'
ID264083
Institutional Source Beutler Lab
Gene Symbol Ssh3
Ensembl Gene ENSMUSG00000034616
Gene Nameslingshot protein phosphatase 3
SynonymsSSH-3
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4261668-4269172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4262559 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 586 (R586H)
Ref Sequence ENSEMBL: ENSMUSP00000109483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037992] [ENSMUST00000113852]
Predicted Effect probably benign
Transcript: ENSMUST00000037992
AA Change: R582H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047718
Gene: ENSMUSG00000034616
AA Change: R582H

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DEK_C 268 321 3.3e-18 PFAM
DSPc 325 463 7.25e-42 SMART
low complexity region 488 507 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113852
AA Change: R586H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109483
Gene: ENSMUSG00000034616
AA Change: R586H

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DEK_C 273 324 1.1e-15 PFAM
DSPc 329 467 7.25e-42 SMART
low complexity region 492 511 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184641
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ADF (actin-depolymerizing factor)/cofilin family (see MIM 601442) is composed of stimulus-responsive mediators of actin dynamics. ADF/cofilin proteins are inactivated by kinases such as LIM domain kinase-1 (LIMK1; MIM 601329). The SSH family appears to play a role in actin dynamics by reactivating ADF/cofilin proteins in vivo (Niwa et al., 2002 [PubMed 11832213]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Ssh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02455:Ssh3 APN 19 4264432 missense probably damaging 1.00
R0398:Ssh3 UTSW 19 4263699 missense possibly damaging 0.72
R0727:Ssh3 UTSW 19 4263991 missense probably damaging 1.00
R1079:Ssh3 UTSW 19 4266549 missense probably damaging 1.00
R2204:Ssh3 UTSW 19 4269073 missense probably damaging 1.00
R2205:Ssh3 UTSW 19 4269073 missense probably damaging 1.00
R2844:Ssh3 UTSW 19 4265296 missense probably damaging 1.00
R2845:Ssh3 UTSW 19 4265296 missense probably damaging 1.00
R2846:Ssh3 UTSW 19 4265296 missense probably damaging 1.00
R4436:Ssh3 UTSW 19 4265366 missense probably damaging 1.00
R4916:Ssh3 UTSW 19 4265142 missense probably damaging 1.00
R5837:Ssh3 UTSW 19 4266400 missense probably benign 0.01
R6392:Ssh3 UTSW 19 4265371 missense probably benign 0.03
R6611:Ssh3 UTSW 19 4264422 missense probably damaging 1.00
R6932:Ssh3 UTSW 19 4264420 missense probably damaging 1.00
X0025:Ssh3 UTSW 19 4265707 missense probably benign 0.01
X0028:Ssh3 UTSW 19 4265993 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACAGCATGAGGGCTTAG -3'
(R):5'- CTAGAAGGAAGCTCAAGCCG -3'

Sequencing Primer
(F):5'- GCTGTCATCTACACTGGCCTG -3'
(R):5'- GAAGCTCAAGCCGGCCAAG -3'
Posted On2015-02-05