Incidental Mutation 'R3083:Incenp'
ID264084
Institutional Source Beutler Lab
Gene Symbol Incenp
Ensembl Gene ENSMUSG00000024660
Gene Nameinner centromere protein
Synonyms2700067E22Rik
Accession Numbers

Genbank: NM_016692

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location9872297-9899533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9883779 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 480 (M480L)
Ref Sequence ENSEMBL: ENSMUSP00000025562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025562]
Predicted Effect unknown
Transcript: ENSMUST00000025562
AA Change: M480L
SMART Domains Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660
AA Change: M480L

DomainStartEndE-ValueType
Pfam:INCENP_N 6 41 1.9e-18 PFAM
low complexity region 83 94 N/A INTRINSIC
low complexity region 123 145 N/A INTRINSIC
low complexity region 308 314 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 517 553 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
SCOP:d1f5na1 631 739 7e-3 SMART
Pfam:INCENP_ARK-bind 789 846 1.5e-22 PFAM
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Incenp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Incenp APN 19 9883728 missense unknown
IGL01717:Incenp APN 19 9893265 splice site probably benign
IGL02485:Incenp APN 19 9893368 missense unknown
IGL02488:Incenp APN 19 9893407 missense unknown
B5639:Incenp UTSW 19 9893818 missense unknown
R0060:Incenp UTSW 19 9885459 splice site probably benign
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0242:Incenp UTSW 19 9893750 missense unknown
R0242:Incenp UTSW 19 9893750 missense unknown
R0284:Incenp UTSW 19 9893993 missense unknown
R1264:Incenp UTSW 19 9884015 missense unknown
R1432:Incenp UTSW 19 9885526 missense unknown
R1679:Incenp UTSW 19 9895414 missense unknown
R1827:Incenp UTSW 19 9872729 missense possibly damaging 0.94
R1970:Incenp UTSW 19 9885487 missense unknown
R3082:Incenp UTSW 19 9883779 missense unknown
R4062:Incenp UTSW 19 9883778 missense unknown
R4063:Incenp UTSW 19 9883778 missense unknown
R4534:Incenp UTSW 19 9883939 missense unknown
R4535:Incenp UTSW 19 9883939 missense unknown
R4536:Incenp UTSW 19 9883939 missense unknown
R4709:Incenp UTSW 19 9876600 missense unknown
R4785:Incenp UTSW 19 9877690 missense unknown
R4785:Incenp UTSW 19 9877691 missense unknown
R5179:Incenp UTSW 19 9894909 missense unknown
R5282:Incenp UTSW 19 9878406 missense unknown
R5400:Incenp UTSW 19 9877675 critical splice donor site probably null
R5502:Incenp UTSW 19 9893364 missense unknown
R5608:Incenp UTSW 19 9893868 small insertion probably benign
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6807:Incenp UTSW 19 9877756 missense unknown
R6885:Incenp UTSW 19 9875132 missense unknown
R6959:Incenp UTSW 19 9876770 missense unknown
R7033:Incenp UTSW 19 9893372 missense unknown
R8258:Incenp UTSW 19 9893629 missense unknown
R8258:Incenp UTSW 19 9893641 missense unknown
R8259:Incenp UTSW 19 9893629 missense unknown
R8259:Incenp UTSW 19 9893641 missense unknown
R8293:Incenp UTSW 19 9875133 nonsense probably null
Z1176:Incenp UTSW 19 9877687 missense unknown
Z1177:Incenp UTSW 19 9899364 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTGAACTCGATCGCCCATCAG -3'
(R):5'- AAGATGAAGAACTGCAGCCC -3'

Sequencing Primer
(F):5'- GATCGCCCATCAGTGTCTGAC -3'
(R):5'- CTGCCAGAATAAGACCCCTTC -3'
Posted On2015-02-05