Mutagenetix > Incidental Mutations

Incidental Mutation 'R3122:Ext2'

264089

Institutional Source

Beutler Lab

Gene Symbol

Ext2

Ensembl Gene

ENSMUSG00000027198

Gene Name

exostoses (multiple) 2

Synonyms

MMRRC Submission

040595-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3122 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93661028-93822568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93813825 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 37 (L37P)

Ref Sequence

ENSEMBL: ENSMUSP00000122144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000111248] [ENSMUST00000125407] [ENSMUST00000145838] [ENSMUST00000184931]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028623
AA Change: L37P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: L37P

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC
Pfam:Exostosin	100	380	2.4e-59	PFAM
Pfam:Glyco_transf_64	456	701	1.1e-99	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111248
AA Change: L37P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106879
Gene: ENSMUSG00000027198
AA Change: L37P

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123649

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125027

Predicted Effect

probably damaging
Transcript: ENSMUST00000125407
AA Change: L37P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198
AA Change: L37P

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC
Pfam:Exostosin	100	380	8.8e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000145838
AA Change: L37P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122144
Gene: ENSMUSG00000027198
AA Change: L37P

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC
Pfam:Exostosin	100	213	2.5e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157046

Predicted Effect

probably damaging
Transcript: ENSMUST00000184931
AA Change: L37P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198
AA Change: L37P

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC
Pfam:Exostosin	100	380	1.4e-57	PFAM
Pfam:Glyco_transf_64	456	559	9.5e-31	PFAM

Meta Mutation Damage Score

0.8588

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	T	C	8: 24,628,232	N8S	possibly damaging	Het
Ago3	A	G	4: 126,417,372	I16T	probably benign	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Brdt	A	G	5: 107,377,145	T851A	probably damaging	Het
Capn7	A	T	14: 31,359,210	I395F	probably damaging	Het
Ccbe1	A	G	18: 66,066,829	M274T	probably benign	Het
Ccdc146	T	C	5: 21,294,593	R864G	possibly damaging	Het
Ccdc17	G	T	4: 116,599,552		probably benign	Het
Ccdc85a	C	A	11: 28,583,499	C15F	unknown	Het
Cpt1c	A	G	7: 44,959,921	Y715H	probably damaging	Het
Dmwd	T	A	7: 19,080,695	F423L	probably damaging	Het
Dock3	C	G	9: 106,911,343	A1598P	probably damaging	Het
Fam120a	T	C	13: 48,892,086	D758G	possibly damaging	Het
Foxn4	T	C	5: 114,258,715	T236A	probably damaging	Het
Gm9776	A	T	13: 94,358,686		probably benign	Het
Grik1	A	T	16: 88,006,473	M277K	probably damaging	Het
H2-T23	T	A	17: 36,030,963	M248L	probably benign	Het
Hephl1	A	G	9: 15,088,969	F329S	possibly damaging	Het
Kif13a	G	A	13: 46,764,596		probably benign	Het
Knl1	T	A	2: 119,068,944	H375Q	probably benign	Het
Lox	A	G	18: 52,525,105	F332S	probably damaging	Het
Ltf	G	A	9: 111,022,900	C135Y	probably damaging	Het
Madd	A	G	2: 91,176,209	Y347H	probably damaging	Het
Mboat1	T	C	13: 30,238,048	Y387H	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	T	C	13: 100,408,995	T1342A	probably damaging	Het
Naip6	T	C	13: 100,316,523	D10G	probably benign	Het
Nudt8	A	G	19: 4,002,015	R209G	possibly damaging	Het
Olfr1082	A	T	2: 86,594,610	Y73N	possibly damaging	Het
Olfr1183	G	T	2: 88,461,509	M75I	probably damaging	Het
Olfr679	T	C	7: 105,086,178	V154A	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Phactr1	T	A	13: 43,059,573	S131T	possibly damaging	Het
Phactr3	A	G	2: 178,331,618	I475V	probably damaging	Het
Pip	T	A	6: 41,851,885	N121K	probably damaging	Het
Pla2g4d	T	C	2: 120,278,903	R222G	probably benign	Het
Rbm42	A	G	7: 30,649,727		probably benign	Het
Sowahb	T	C	5: 93,043,402	D486G	possibly damaging	Het
Svep1	C	T	4: 58,087,845	V1745I	possibly damaging	Het
Tnfsf15	T	A	4: 63,734,285	E96D	probably benign	Het
Vmn1r217	A	G	13: 23,114,079	S218P	probably damaging	Het
Vmn2r71	T	G	7: 85,615,620	Y53*	probably null	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wapl	A	G	14: 34,729,215	I729M	possibly damaging	Het
Wrnip1	A	G	13: 32,802,761	D175G	probably benign	Het
Zscan2	G	A	7: 80,863,344	A26T	probably benign	Het

Other mutations in Ext2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01132:Ext2	APN	2	93791073	missense	probably benign
IGL01554:Ext2	APN	2	93811949	missense	probably damaging	1.00
IGL01768:Ext2	APN	2	93791110	splice site	probably benign
IGL02160:Ext2	APN	2	93813584	missense	probably benign
IGL02677:Ext2	APN	2	93707245	missense	probably damaging	1.00
IGL02939:Ext2	APN	2	93704619	splice site	probably null
IGL03013:Ext2	APN	2	93707226	intron	probably benign
IGL03286:Ext2	APN	2	93707272	missense	probably damaging	1.00
R0018:Ext2	UTSW	2	93795692	missense	probably damaging	1.00
R0526:Ext2	UTSW	2	93806085	missense	probably damaging	0.99
R0580:Ext2	UTSW	2	93795725	missense	probably benign	0.31
R1383:Ext2	UTSW	2	93806113	missense	possibly damaging	0.92
R1538:Ext2	UTSW	2	93707287	missense	probably damaging	1.00
R1743:Ext2	UTSW	2	93730225	missense	probably damaging	1.00
R1792:Ext2	UTSW	2	93704545	missense	probably damaging	1.00
R2874:Ext2	UTSW	2	93739686	missense	possibly damaging	0.95
R4624:Ext2	UTSW	2	93703200	missense	probably benign	0.26
R4653:Ext2	UTSW	2	93696159	missense	probably benign	0.22
R4826:Ext2	UTSW	2	93762630	missense	probably benign	0.15
R4828:Ext2	UTSW	2	93795767	missense	probably benign	0.08
R4936:Ext2	UTSW	2	93813679	nonsense	probably null
R5311:Ext2	UTSW	2	93696261	missense	probably benign	0.04
R5799:Ext2	UTSW	2	93811972	missense	probably benign	0.01
R5850:Ext2	UTSW	2	93813659	missense	possibly damaging	0.94
R6230:Ext2	UTSW	2	93762620	missense	probably damaging	1.00
R6488:Ext2	UTSW	2	93806085	missense	probably damaging	0.99
R7047:Ext2	UTSW	2	93739657	missense	probably damaging	0.99
R7173:Ext2	UTSW	2	93813612	missense	probably damaging	1.00
R7391:Ext2	UTSW	2	93730267	missense	probably damaging	1.00
R7530:Ext2	UTSW	2	93661653	missense	probably benign	0.00
R7545:Ext2	UTSW	2	93813763	missense	probably benign
Z1177:Ext2	UTSW	2	93703275	critical splice acceptor site	unknown

Predicted Primers

PCR Primer
(F):5'- TCTTTGGGTTGAAGCCGCAG -3'
(R):5'- AATCCAATCCACGCAGGGTATTG -3'

Sequencing Primer
(F):5'- CGCAGCGGTAGACATCGAAAC -3'
(R):5'- CAATCCACGCAGGGTATTGATTGC -3'

Posted On

2015-02-05