Mutagenetix > Incidental Mutations

Incidental Mutation 'R3122:Brdt'

264101

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

040595-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3122 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107377145 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 851 (T851A)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031215
AA Change: T851A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: T851A

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162804

Meta Mutation Damage Score

0.0676

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	T	C	8: 24,628,232	N8S	possibly damaging	Het
Ago3	A	G	4: 126,417,372	I16T	probably benign	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Capn7	A	T	14: 31,359,210	I395F	probably damaging	Het
Ccbe1	A	G	18: 66,066,829	M274T	probably benign	Het
Ccdc146	T	C	5: 21,294,593	R864G	possibly damaging	Het
Ccdc17	G	T	4: 116,599,552		probably benign	Het
Ccdc85a	C	A	11: 28,583,499	C15F	unknown	Het
Cpt1c	A	G	7: 44,959,921	Y715H	probably damaging	Het
Dmwd	T	A	7: 19,080,695	F423L	probably damaging	Het
Dock3	C	G	9: 106,911,343	A1598P	probably damaging	Het
Ext2	A	G	2: 93,813,825	L37P	probably damaging	Het
Fam120a	T	C	13: 48,892,086	D758G	possibly damaging	Het
Foxn4	T	C	5: 114,258,715	T236A	probably damaging	Het
Gm9776	A	T	13: 94,358,686		probably benign	Het
Grik1	A	T	16: 88,006,473	M277K	probably damaging	Het
H2-T23	T	A	17: 36,030,963	M248L	probably benign	Het
Hephl1	A	G	9: 15,088,969	F329S	possibly damaging	Het
Kif13a	G	A	13: 46,764,596		probably benign	Het
Knl1	T	A	2: 119,068,944	H375Q	probably benign	Het
Lox	A	G	18: 52,525,105	F332S	probably damaging	Het
Ltf	G	A	9: 111,022,900	C135Y	probably damaging	Het
Madd	A	G	2: 91,176,209	Y347H	probably damaging	Het
Mboat1	T	C	13: 30,238,048	Y387H	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	T	C	13: 100,408,995	T1342A	probably damaging	Het
Naip6	T	C	13: 100,316,523	D10G	probably benign	Het
Nudt8	A	G	19: 4,002,015	R209G	possibly damaging	Het
Olfr1082	A	T	2: 86,594,610	Y73N	possibly damaging	Het
Olfr1183	G	T	2: 88,461,509	M75I	probably damaging	Het
Olfr679	T	C	7: 105,086,178	V154A	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Phactr1	T	A	13: 43,059,573	S131T	possibly damaging	Het
Phactr3	A	G	2: 178,331,618	I475V	probably damaging	Het
Pip	T	A	6: 41,851,885	N121K	probably damaging	Het
Pla2g4d	T	C	2: 120,278,903	R222G	probably benign	Het
Rbm42	A	G	7: 30,649,727		probably benign	Het
Sowahb	T	C	5: 93,043,402	D486G	possibly damaging	Het
Svep1	C	T	4: 58,087,845	V1745I	possibly damaging	Het
Tnfsf15	T	A	4: 63,734,285	E96D	probably benign	Het
Vmn1r217	A	G	13: 23,114,079	S218P	probably damaging	Het
Vmn2r71	T	G	7: 85,615,620	Y53*	probably null	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wapl	A	G	14: 34,729,215	I729M	possibly damaging	Het
Wrnip1	A	G	13: 32,802,761	D175G	probably benign	Het
Zscan2	G	A	7: 80,863,344	A26T	probably benign	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TCTGATTGACATCTAACATAGGCTG -3'
(R):5'- GGAAATGCTTGGAAGACAGTTC -3'

Sequencing Primer
(F):5'- GTTTAGGGAAGCCAGTGAA -3'
(R):5'- TGTAATGACAATTTGTTGTGTGTTC -3'

Posted On

2015-02-05