Incidental Mutation 'R3122:Wrnip1'
ID264121
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene NameWerner helicase interacting protein 1
Synonyms4833444L21Rik, WHIP
MMRRC Submission 040595-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3122 (G1)
Quality Score203
Status Validated
Chromosome13
Chromosomal Location32802038-32822609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32802761 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 175 (D175G)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832] [ENSMUST00000057911]
Predicted Effect probably benign
Transcript: ENSMUST00000021832
AA Change: D175G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: D175G

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000057911
AA Change: V30A
SMART Domains Protein: ENSMUSP00000050235
Gene: ENSMUSG00000042874
AA Change: V30A

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 37 46 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Meta Mutation Damage Score 0.0745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,628,232 N8S possibly damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccbe1 A G 18: 66,066,829 M274T probably benign Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc17 G T 4: 116,599,552 probably benign Het
Ccdc85a C A 11: 28,583,499 C15F unknown Het
Cpt1c A G 7: 44,959,921 Y715H probably damaging Het
Dmwd T A 7: 19,080,695 F423L probably damaging Het
Dock3 C G 9: 106,911,343 A1598P probably damaging Het
Ext2 A G 2: 93,813,825 L37P probably damaging Het
Fam120a T C 13: 48,892,086 D758G possibly damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm9776 A T 13: 94,358,686 probably benign Het
Grik1 A T 16: 88,006,473 M277K probably damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Hephl1 A G 9: 15,088,969 F329S possibly damaging Het
Kif13a G A 13: 46,764,596 probably benign Het
Knl1 T A 2: 119,068,944 H375Q probably benign Het
Lox A G 18: 52,525,105 F332S probably damaging Het
Ltf G A 9: 111,022,900 C135Y probably damaging Het
Madd A G 2: 91,176,209 Y347H probably damaging Het
Mboat1 T C 13: 30,238,048 Y387H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 T C 13: 100,408,995 T1342A probably damaging Het
Naip6 T C 13: 100,316,523 D10G probably benign Het
Nudt8 A G 19: 4,002,015 R209G possibly damaging Het
Olfr1082 A T 2: 86,594,610 Y73N possibly damaging Het
Olfr1183 G T 2: 88,461,509 M75I probably damaging Het
Olfr679 T C 7: 105,086,178 V154A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Phactr1 T A 13: 43,059,573 S131T possibly damaging Het
Phactr3 A G 2: 178,331,618 I475V probably damaging Het
Pip T A 6: 41,851,885 N121K probably damaging Het
Pla2g4d T C 2: 120,278,903 R222G probably benign Het
Rbm42 A G 7: 30,649,727 probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Svep1 C T 4: 58,087,845 V1745I possibly damaging Het
Tnfsf15 T A 4: 63,734,285 E96D probably benign Het
Vmn1r217 A G 13: 23,114,079 S218P probably damaging Het
Vmn2r71 T G 7: 85,615,620 Y53* probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Zscan2 G A 7: 80,863,344 A26T probably benign Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 32816329 missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32806874 missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 32822070 missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 32820297 missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32806864 missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 32821906 missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32806813 missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 32821090 missense possibly damaging 0.82
R1650:Wrnip1 UTSW 13 32805379 missense probably benign 0.02
R1894:Wrnip1 UTSW 13 32805336 critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 32820240 missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32802427 missense probably benign
R2475:Wrnip1 UTSW 13 32806958 missense probably benign 0.30
R4247:Wrnip1 UTSW 13 32806883 missense probably damaging 1.00
R4604:Wrnip1 UTSW 13 32802347 missense probably damaging 1.00
R4978:Wrnip1 UTSW 13 32816312 missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 32816336 missense probably damaging 1.00
R5148:Wrnip1 UTSW 13 32806856 missense probably damaging 1.00
R5929:Wrnip1 UTSW 13 32806966 missense probably damaging 1.00
R6750:Wrnip1 UTSW 13 32802756 missense probably damaging 0.99
R7137:Wrnip1 UTSW 13 32802749 missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32802633 missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 32816281 missense probably benign 0.33
R7468:Wrnip1 UTSW 13 32816377 missense possibly damaging 0.80
R7470:Wrnip1 UTSW 13 32816327 nonsense probably null
R8049:Wrnip1 UTSW 13 32821977 missense probably benign
R8260:Wrnip1 UTSW 13 32805356 missense possibly damaging 0.80
X0019:Wrnip1 UTSW 13 32806766 missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32802724 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCAATTCGCACCTGGACC -3'
(R):5'- ATGTAGTCCTGCAGCGTGTC -3'

Sequencing Primer
(F):5'- AAGAGGCGTCGACTGTCG -3'
(R):5'- GTCTGGACGCATCTTGTCAGC -3'
Posted On2015-02-05