Incidental Mutation 'R3123:Ctsa'
ID264144
Institutional Source Beutler Lab
Gene Symbol Ctsa
Ensembl Gene ENSMUSG00000017760
Gene Namecathepsin A
SynonymsPpgb, PPCA
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164832873-164841032 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 164835232 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017904] [ENSMUST00000042775] [ENSMUST00000059954] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000109316] [ENSMUST00000109317] [ENSMUST00000127650] [ENSMUST00000143780] [ENSMUST00000151493] [ENSMUST00000152721]
Predicted Effect probably damaging
Transcript: ENSMUST00000017904
AA Change: L187Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017904
Gene: ENSMUSG00000017760
AA Change: L187Q

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Peptidase_S10 52 489 2.5e-140 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000042775
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059954
SMART Domains Protein: ENSMUSP00000061519
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103092
AA Change: L187Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760
AA Change: L187Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103093
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760
AA Change: L169Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109316
SMART Domains Protein: ENSMUSP00000104939
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109317
SMART Domains Protein: ENSMUSP00000104940
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 191 1.77e-40 SMART
BPI2 206 408 1.35e-68 SMART
low complexity region 425 441 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127650
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760
AA Change: L169Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143293
Predicted Effect probably benign
Transcript: ENSMUST00000143780
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147883
Predicted Effect probably benign
Transcript: ENSMUST00000151493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152721
SMART Domains Protein: ENSMUSP00000119814
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
Pfam:Peptidase_S10 45 227 1.7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155061
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein with deamidase, esterase and carboxypeptidase activities. The encoded protein associates with and provides a protective function to the lysosomal enzymes beta-galactosidase and neuraminidase. Deficiency of the related gene in humans results in galactosialidosis. The proprotein is processed into two shorter chains. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutants show aberrant lysosomal storage, with vacuolization in specific cells of most tissues. An abormally flat face and reduced body size are apparent at birth, and health progressively deteriorates, with accompanying generalized edema, ataxia and tremors. Death occurs at ~12 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Ctsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Ctsa APN 2 164834310 unclassified probably benign
IGL02489:Ctsa APN 2 164838645 missense probably damaging 0.96
IGL02522:Ctsa APN 2 164839141 unclassified probably benign
IGL03008:Ctsa APN 2 164837448 missense probably damaging 1.00
R2058:Ctsa UTSW 2 164834902 missense probably null 0.00
R2402:Ctsa UTSW 2 164834893 missense probably benign 0.36
R4270:Ctsa UTSW 2 164835302 missense probably benign 0.00
R4588:Ctsa UTSW 2 164834150 missense possibly damaging 0.62
R5236:Ctsa UTSW 2 164838911 missense probably damaging 1.00
R5331:Ctsa UTSW 2 164834309 unclassified probably benign
R6258:Ctsa UTSW 2 164834361 missense probably damaging 1.00
R6260:Ctsa UTSW 2 164834361 missense probably damaging 1.00
R6853:Ctsa UTSW 2 164837364 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCTCTGGTAAACTCAACC -3'
(R):5'- AGCTATCGGAGTAGCCAGTG -3'

Sequencing Primer
(F):5'- TGGTAAACTCAACCAGTCCACTTC -3'
(R):5'- CCTAATCCTAGGTCACAGC -3'
Posted On2015-02-05