Incidental Mutation 'R3123:Csn1s2b'
ID264146
Institutional Source Beutler Lab
Gene Symbol Csn1s2b
Ensembl Gene ENSMUSG00000061388
Gene Namecasein alpha s2-like B
SynonymsCsnd, Csne
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87808082-87824426 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 87819058 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072539] [ENSMUST00000101057] [ENSMUST00000113279] [ENSMUST00000197301]
Predicted Effect probably benign
Transcript: ENSMUST00000072539
SMART Domains Protein: ENSMUSP00000072352
Gene: ENSMUSG00000061388

DomainStartEndE-ValueType
Pfam:Casein 58 136 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101057
Predicted Effect probably benign
Transcript: ENSMUST00000113279
SMART Domains Protein: ENSMUSP00000108904
Gene: ENSMUSG00000061388

DomainStartEndE-ValueType
Pfam:Casein 55 133 5.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197301
SMART Domains Protein: ENSMUSP00000142449
Gene: ENSMUSG00000061388

DomainStartEndE-ValueType
Pfam:Casein 45 127 7.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Csn1s2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Csn1s2b APN 5 87820951 nonsense probably null
IGL01704:Csn1s2b APN 5 87813111 missense probably damaging 1.00
IGL01785:Csn1s2b APN 5 87809913 missense possibly damaging 0.91
IGL02689:Csn1s2b APN 5 87809921 missense probably benign 0.41
R1596:Csn1s2b UTSW 5 87819058 splice site probably benign
R1649:Csn1s2b UTSW 5 87819084 missense probably benign 0.07
R1682:Csn1s2b UTSW 5 87822303 missense probably damaging 0.98
R1747:Csn1s2b UTSW 5 87816670 splice site probably benign
R4667:Csn1s2b UTSW 5 87822311 missense possibly damaging 0.53
R4781:Csn1s2b UTSW 5 87819093 missense possibly damaging 0.77
R4965:Csn1s2b UTSW 5 87813961 missense possibly damaging 0.81
R6013:Csn1s2b UTSW 5 87824239 utr 3 prime probably null
R6730:Csn1s2b UTSW 5 87822268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATGTGTCAGGAATGATAGAGAC -3'
(R):5'- TGTTTAAATCTGAGCCACCCC -3'

Sequencing Primer
(F):5'- GTGTCAGGAATGATAGAGACATTTC -3'
(R):5'- AAATCTGAGCCACCCCCTTTC -3'
Posted On2015-02-05