Incidental Mutation 'R3123:Zfp574'
ID264151
Institutional Source Beutler Lab
Gene Symbol Zfp574
Ensembl Gene ENSMUSG00000045252
Gene Namezinc finger protein 574
SynonymsA630056B21Rik
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25072567-25083492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25081601 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 683 (A683S)
Ref Sequence ENSEMBL: ENSMUSP00000136547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053410] [ENSMUST00000179556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053410
AA Change: A683S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057817
Gene: ENSMUSG00000045252
AA Change: A683S

DomainStartEndE-ValueType
ZnF_C2H2 16 38 4.98e-1 SMART
ZnF_C2H2 76 98 4.05e-1 SMART
low complexity region 107 118 N/A INTRINSIC
ZnF_C2H2 126 148 1.99e0 SMART
low complexity region 156 173 N/A INTRINSIC
ZnF_C2H2 213 235 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
ZnF_C2H2 312 334 7.15e-2 SMART
ZnF_C2H2 339 361 1.04e-3 SMART
ZnF_C2H2 367 389 4.12e0 SMART
ZnF_C2H2 395 416 2.12e1 SMART
low complexity region 418 434 N/A INTRINSIC
ZnF_C2H2 469 492 1.03e-2 SMART
ZnF_C2H2 498 520 2.75e-3 SMART
ZnF_C2H2 526 548 3.39e-3 SMART
ZnF_C2H2 554 576 2.75e-3 SMART
ZnF_C2H2 582 604 2.86e-1 SMART
ZnF_C2H2 610 633 1.25e-1 SMART
ZnF_C2H2 639 659 4.5e1 SMART
low complexity region 660 666 N/A INTRINSIC
ZnF_C2H2 670 692 2.29e0 SMART
ZnF_C2H2 742 764 2.91e-2 SMART
ZnF_C2H2 770 792 5.59e-4 SMART
ZnF_C2H2 798 820 3.34e-2 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179556
AA Change: A683S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136547
Gene: ENSMUSG00000045252
AA Change: A683S

DomainStartEndE-ValueType
ZnF_C2H2 16 38 4.98e-1 SMART
ZnF_C2H2 76 98 4.05e-1 SMART
low complexity region 107 118 N/A INTRINSIC
ZnF_C2H2 126 148 1.99e0 SMART
low complexity region 156 173 N/A INTRINSIC
ZnF_C2H2 213 235 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
ZnF_C2H2 312 334 7.15e-2 SMART
ZnF_C2H2 339 361 1.04e-3 SMART
ZnF_C2H2 367 389 4.12e0 SMART
ZnF_C2H2 395 416 2.12e1 SMART
low complexity region 418 434 N/A INTRINSIC
ZnF_C2H2 469 492 1.03e-2 SMART
ZnF_C2H2 498 520 2.75e-3 SMART
ZnF_C2H2 526 548 3.39e-3 SMART
ZnF_C2H2 554 576 2.75e-3 SMART
ZnF_C2H2 582 604 2.86e-1 SMART
ZnF_C2H2 610 633 1.25e-1 SMART
ZnF_C2H2 639 659 4.5e1 SMART
low complexity region 660 666 N/A INTRINSIC
ZnF_C2H2 670 692 2.29e0 SMART
ZnF_C2H2 742 764 2.91e-2 SMART
ZnF_C2H2 770 792 5.59e-4 SMART
ZnF_C2H2 798 820 3.34e-2 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206733
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Zfp574
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zfp574 APN 7 25081590 missense probably benign 0.00
IGL02370:Zfp574 APN 7 25079589 missense possibly damaging 0.95
IGL02706:Zfp574 APN 7 25081365 missense probably damaging 0.98
IGL03119:Zfp574 APN 7 25080473 missense probably benign
glue UTSW 7 25081090 missense probably damaging 0.98
R0866:Zfp574 UTSW 7 25079898 missense probably damaging 1.00
R2429:Zfp574 UTSW 7 25080057 nonsense probably null
R3124:Zfp574 UTSW 7 25081601 missense possibly damaging 0.88
R3125:Zfp574 UTSW 7 25081601 missense possibly damaging 0.88
R4581:Zfp574 UTSW 7 25081313 missense probably damaging 0.98
R4591:Zfp574 UTSW 7 25079544 start gained probably benign
R4915:Zfp574 UTSW 7 25080726 missense probably damaging 0.98
R4953:Zfp574 UTSW 7 25080963 missense probably damaging 0.97
R5305:Zfp574 UTSW 7 25081090 missense probably damaging 0.98
R5541:Zfp574 UTSW 7 25081950 missense probably damaging 0.99
R5934:Zfp574 UTSW 7 25080332 missense probably benign
R6088:Zfp574 UTSW 7 25080339 missense probably benign 0.01
R7061:Zfp574 UTSW 7 25080197 missense possibly damaging 0.95
R7563:Zfp574 UTSW 7 25081352 missense possibly damaging 0.94
R7615:Zfp574 UTSW 7 25080576 missense possibly damaging 0.95
X0026:Zfp574 UTSW 7 25081052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACCAGCTTGTGATCCATG -3'
(R):5'- ATGGACCTGTAGTGACGTCTCTG -3'

Sequencing Primer
(F):5'- CTTGTGATCCATGCTGGGC -3'
(R):5'- GAAGAGCTTCTTGCACTCACTG -3'
Posted On2015-02-05