Mutagenetix > Incidental Mutation

Incidental Mutation 'R3123:Upf1'

264154

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

040596-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R3123 (G1)

Quality Score

112

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 70337483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably benign
Transcript: ENSMUST00000075666

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215817

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak9	A	G	10: 41,358,580	I646V	possibly damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Caskin2	T	C	11: 115,804,797	D246G	probably damaging	Het
Csn1s2b	T	C	5: 87,819,058		probably benign	Het
Ctsa	T	A	2: 164,835,232		probably null	Het
Cyp2j8	G	A	4: 96,501,213		probably benign	Het
Dach2	T	C	X: 113,819,967	I417T	possibly damaging	Het
Dhx9	T	C	1: 153,465,706	K599E	possibly damaging	Het
Duox2	A	G	2: 122,281,073		probably benign	Het
F2rl3	T	C	8: 72,763,212	S356P	probably damaging	Het
Fem1b	T	C	9: 62,796,554	I475V	probably benign	Het
Glra3	A	G	8: 56,125,209	R434G	possibly damaging	Het
Gpr75	T	A	11: 30,891,709	S205T	possibly damaging	Het
Hsd17b12	C	T	2: 94,033,958	R268Q	probably benign	Het
Htt	T	C	5: 34,804,531	S287P	probably benign	Het
Ifi27l2b	T	C	12: 103,451,335	T198A	unknown	Het
Kdm5d	T	C	Y: 900,558	V201A	possibly damaging	Het
Khdrbs2	C	A	1: 32,519,777	R408L	probably damaging	Het
Lonp1	A	G	17: 56,626,488	I129T	possibly damaging	Het
Macc1	T	C	12: 119,447,633	F712S	probably damaging	Het
Mcpt8	A	T	14: 56,083,941	I22K	probably damaging	Het
Nop2	G	A	6: 125,132,201		probably benign	Het
Olfr1115	A	T	2: 87,252,791	T285S	possibly damaging	Het
Olfr131	G	A	17: 38,082,012		probably null	Het
Olfr166	A	G	16: 19,487,015	Y59C	probably damaging	Het
Pet2	A	T	X: 89,404,721	Y601N	probably benign	Het
Pkd1l1	T	A	11: 8,973,021	D82V	unknown	Het
Polr2a	A	T	11: 69,735,710	S1566T	possibly damaging	Het
Ppwd1	C	T	13: 104,213,690	E396K	possibly damaging	Het
Prr30	A	G	14: 101,198,989	S46P	probably benign	Het
Pthlh	A	T	6: 147,263,291	V27E	probably damaging	Het
Ptpn4	A	G	1: 119,765,423		probably null	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Ralgps1	T	C	2: 33,158,956	T314A	possibly damaging	Het
Rbm27	A	G	18: 42,327,165	E764G	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Taf15	G	A	11: 83,504,328		probably null	Het
Tas2r140	T	A	6: 133,055,241	I185L	probably benign	Het
Tgfbr2	G	A	9: 116,110,069	T230M	possibly damaging	Het
Tnpo1	GCACCTCTGCTTCCTC	GCACCTCTGCTTCCTCACCTCTGCTTCCTC	13: 98,867,129		probably null	Het
Togaram1	G	T	12: 64,966,344	R123L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim9	C	T	12: 70,248,393	G648R	probably damaging	Het
Vmn2r109	C	T	17: 20,540,986	C703Y	probably damaging	Het
Zfp574	G	T	7: 25,081,601	A683S	possibly damaging	Het
Zfp777	A	G	6: 48,029,116		probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGTTAACCCCTCCATGTTCCTAAG -3'
(R):5'- ATGTGCCCTGATGTCTGTGC -3'

Sequencing Primer
(F):5'- TGCCTACCACAGGGACAG -3'
(R):5'- TGCCTTCCCCAGAATGCAGATG -3'

Posted On

2015-02-05