Incidental Mutation 'R3123:F2rl3'
ID264155
Institutional Source Beutler Lab
Gene Symbol F2rl3
Ensembl Gene ENSMUSG00000050147
Gene Namecoagulation factor II (thrombin) receptor-like 3
SynonymsPAR4
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72761880-72763874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72763212 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 356 (S356P)
Ref Sequence ENSEMBL: ENSMUSP00000054426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058099]
PDB Structure
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR4 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000058099
AA Change: S356P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054426
Gene: ENSMUSG00000050147
AA Change: S356P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2PV9|C 51 76 5e-12 PDB
Pfam:7TM_GPCR_Srsx 100 367 4.1e-8 PFAM
Pfam:7tm_1 106 352 7.6e-37 PFAM
low complexity region 369 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213063
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the protease-activated receptor subfamily, part of the G-protein coupled receptor 1 family of proteins. The encoded receptor is proteolytically processed to reveal an extracellular N-terminal tethered ligand that binds to and activates the receptor. This receptor plays a role in blood coagulation, inflammation and response to pain. Mice lacking a functional copy of this gene exhibit impaired platelet activation and prolonged bleeding times. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in prolonged bleeding time and protection against thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in F2rl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0276:F2rl3 UTSW 8 72762798 missense probably benign
R0748:F2rl3 UTSW 8 72762751 missense probably benign 0.00
R1640:F2rl3 UTSW 8 72762906 missense probably benign 0.13
R4546:F2rl3 UTSW 8 72762583 missense probably benign
R4718:F2rl3 UTSW 8 72762908 missense possibly damaging 0.61
R5000:F2rl3 UTSW 8 72762679 missense probably damaging 1.00
R6150:F2rl3 UTSW 8 72762738 missense probably benign 0.01
R6195:F2rl3 UTSW 8 72762885 missense probably benign
R6233:F2rl3 UTSW 8 72762885 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGCTGTGTCATGATGCG -3'
(R):5'- GAGACCCAGTCAAGCCAGAATG -3'

Sequencing Primer
(F):5'- GACTGACAGCCCTGGTACTGTTC -3'
(R):5'- GCCAGAATGCCCCCTTC -3'
Posted On2015-02-05