Incidental Mutation 'R3123:Fem1b'
ID264157
Institutional Source Beutler Lab
Gene Symbol Fem1b
Ensembl Gene ENSMUSG00000032244
Gene Namefeminization 1 homolog b (C. elegans)
Synonyms
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62791821-62811934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62796554 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 475 (I475V)
Ref Sequence ENSEMBL: ENSMUSP00000034775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034775]
Predicted Effect probably benign
Transcript: ENSMUST00000034775
AA Change: I475V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034775
Gene: ENSMUSG00000032244
AA Change: I475V

DomainStartEndE-ValueType
ANK 45 74 6.81e-3 SMART
ANK 87 116 6.65e-6 SMART
ANK 120 149 8.39e-3 SMART
ANK 153 182 8.91e-7 SMART
ANK 186 215 4.13e-2 SMART
ANK 218 246 6.71e-2 SMART
ANK 483 527 1.72e1 SMART
ANK 531 570 6.05e2 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous targeted mutants display abnormal glucose tolerance due to defective glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Fem1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Fem1b APN 9 62796919 missense probably damaging 1.00
IGL01306:Fem1b APN 9 62797528 missense possibly damaging 0.69
IGL02059:Fem1b APN 9 62796164 missense possibly damaging 0.57
IGL02292:Fem1b APN 9 62796695 missense probably benign 0.00
IGL03390:Fem1b APN 9 62796964 missense probably benign 0.01
ANU23:Fem1b UTSW 9 62797528 missense possibly damaging 0.69
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0733:Fem1b UTSW 9 62796843 missense possibly damaging 0.50
R1661:Fem1b UTSW 9 62797274 missense probably damaging 0.96
R1697:Fem1b UTSW 9 62797174 missense possibly damaging 0.56
R2228:Fem1b UTSW 9 62796738 nonsense probably null
R2326:Fem1b UTSW 9 62797003 missense probably damaging 0.98
R3124:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3125:Fem1b UTSW 9 62796554 missense probably benign 0.00
R4849:Fem1b UTSW 9 62797294 missense probably damaging 1.00
R5749:Fem1b UTSW 9 62797006 missense probably damaging 1.00
R6338:Fem1b UTSW 9 62797011 missense probably benign 0.08
R6727:Fem1b UTSW 9 62796733 missense possibly damaging 0.65
R7036:Fem1b UTSW 9 62797028 missense probably damaging 1.00
R7287:Fem1b UTSW 9 62796122 missense probably benign 0.00
R7538:Fem1b UTSW 9 62811167 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGATAATGTGGAGGGCACTG -3'
(R):5'- ACATAGAGTGCGTTTTGAGATGC -3'

Sequencing Primer
(F):5'- ATAATGTGGAGGGCACTGTTCCC -3'
(R):5'- TGCAGTGTCTTGGAAATAGAGC -3'
Posted On2015-02-05