Incidental Mutation 'R3123:Taf15'
ID264162
Institutional Source Beutler Lab
Gene Symbol Taf15
Ensembl Gene ENSMUSG00000020680
Gene NameTATA-box binding protein associated factor 15
SynonymsTAFII68, 2610111C21Rik, Taf2n, 68kDa
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83473086-83506743 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 83504328 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021018]
Predicted Effect probably null
Transcript: ENSMUST00000021018
SMART Domains Protein: ENSMUSP00000021018
Gene: ENSMUSG00000020680

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 44 70 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 103 128 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 173 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
RRM 233 314 1.34e-15 SMART
low complexity region 324 349 N/A INTRINSIC
ZnF_RBZ 354 380 1.62e-5 SMART
low complexity region 388 540 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133170
SMART Domains Protein: ENSMUSP00000119836
Gene: ENSMUSG00000020680

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
RRM 40 121 1.34e-15 SMART
low complexity region 131 156 N/A INTRINSIC
ZnF_RBZ 161 187 1.62e-5 SMART
low complexity region 195 312 N/A INTRINSIC
Meta Mutation Damage Score 0.9601 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TET family of RNA-binding proteins. The encoded protein plays a role in RNA polymerase II gene transcription as a component of a distinct subset of multi-subunit transcription initiation factor TFIID complexes. Translocations involving this gene play a role in acute leukemia and extraskeletal myxoid chondrosarcoma, and mutations in this gene may play a role in amyotrophic lateral sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Taf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Taf15 APN 11 83488923 critical splice acceptor site probably null
IGL01151:Taf15 APN 11 83487371 missense possibly damaging 0.93
R0942:Taf15 UTSW 11 83499106 missense probably damaging 1.00
R1530:Taf15 UTSW 11 83487296 missense possibly damaging 0.86
R2267:Taf15 UTSW 11 83497262 missense probably damaging 0.98
R2437:Taf15 UTSW 11 83504753 intron probably benign
R3155:Taf15 UTSW 11 83502773 missense probably benign 0.03
R3784:Taf15 UTSW 11 83506422 missense unknown
R4491:Taf15 UTSW 11 83484694 missense probably benign 0.08
R4951:Taf15 UTSW 11 83484811 missense possibly damaging 0.64
R5104:Taf15 UTSW 11 83487396 missense probably damaging 1.00
R6814:Taf15 UTSW 11 83499089 missense probably damaging 1.00
R6987:Taf15 UTSW 11 83484695 missense possibly damaging 0.48
R7328:Taf15 UTSW 11 83484832 missense possibly damaging 0.96
R7431:Taf15 UTSW 11 83504953 missense unknown
R7624:Taf15 UTSW 11 83505023 missense unknown
X0028:Taf15 UTSW 11 83487396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTCTAGGTATTAAATGGCAC -3'
(R):5'- GGATAAAGAGCTGGCCTACC -3'

Sequencing Primer
(F):5'- CATTAGTGTCTACTGCTGGTT -3'
(R):5'- TGGCCTACCTCCCCCTGAG -3'
Posted On2015-02-05