Incidental Mutation 'R3124:Abhd16b'
ID264186
Institutional Source Beutler Lab
Gene Symbol Abhd16b
Ensembl Gene ENSMUSG00000055882
Gene Nameabhydrolase domain containing 16B
SynonymsBC050777
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181493206-181494980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181494526 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 407 (R407H)
Ref Sequence ENSEMBL: ENSMUSP00000066520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000844] [ENSMUST00000069649] [ENSMUST00000069712] [ENSMUST00000108799] [ENSMUST00000108800] [ENSMUST00000149163] [ENSMUST00000184588] [ENSMUST00000184849]
Predicted Effect probably benign
Transcript: ENSMUST00000000844
SMART Domains Protein: ENSMUSP00000000844
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 199 6.2e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000069649
AA Change: R407H

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066520
Gene: ENSMUSG00000055882
AA Change: R407H

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 174 339 2.9e-11 PFAM
Pfam:Abhydrolase_5 174 341 2.1e-13 PFAM
Pfam:Hydrolase_4 180 308 5.1e-9 PFAM
low complexity region 345 357 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069712
SMART Domains Protein: ENSMUSP00000068888
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 193 5.8e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108799
SMART Domains Protein: ENSMUSP00000104427
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 18 121 1.9e-38 PFAM
Pfam:TPD52 115 220 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108800
SMART Domains Protein: ENSMUSP00000104428
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 179 2.9e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129390
Predicted Effect probably benign
Transcript: ENSMUST00000149163
SMART Domains Protein: ENSMUSP00000117690
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 213 5.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183956
Predicted Effect probably benign
Transcript: ENSMUST00000184588
Predicted Effect probably benign
Transcript: ENSMUST00000184849
SMART Domains Protein: ENSMUSP00000138837
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 9 170 2.4e-54 PFAM
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Abhd16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Abhd16b APN 2 181494738 unclassified probably benign
IGL02237:Abhd16b APN 2 181493557 missense probably benign 0.00
IGL02457:Abhd16b APN 2 181494334 missense probably benign 0.00
PIT4486001:Abhd16b UTSW 2 181493959 missense probably benign 0.39
R1760:Abhd16b UTSW 2 181493404 missense probably damaging 1.00
R2077:Abhd16b UTSW 2 181493416 missense probably benign 0.44
R4779:Abhd16b UTSW 2 181493460 missense possibly damaging 0.59
R5781:Abhd16b UTSW 2 181494154 missense probably damaging 1.00
R6220:Abhd16b UTSW 2 181493785 missense probably damaging 1.00
R6994:Abhd16b UTSW 2 181493668 missense possibly damaging 0.94
R7305:Abhd16b UTSW 2 181493416 missense possibly damaging 0.85
R7850:Abhd16b UTSW 2 181493725 missense not run
R7933:Abhd16b UTSW 2 181493725 missense not run
X0052:Abhd16b UTSW 2 181494265 missense probably damaging 1.00
X0066:Abhd16b UTSW 2 181493713 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATGCCATCTTGCCAAGTGGAG -3'
(R):5'- AATTGGAAGTCCTCAGGCTCC -3'

Sequencing Primer
(F):5'- TAACCGTGGCAATGAGCTGC -3'
(R):5'- TCCAGTGGACTGCAGTGAG -3'
Posted On2015-02-05