Incidental Mutation 'R3124:Skil'
List |< first << previous [record 27 of 38] next >> last >|
ID264187
Institutional Source Beutler Lab
Gene Symbol Skil
Ensembl Gene ENSMUSG00000027660
Gene NameSKI-like
Synonyms9130011J04Rik, SnoN2, Skir, SnoN, sno-dE3
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location31095058-31122577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31097338 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3 (N3S)
Ref Sequence ENSEMBL: ENSMUSP00000113256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029194] [ENSMUST00000117728] [ENSMUST00000118204] [ENSMUST00000118470] [ENSMUST00000123532]
Predicted Effect probably benign
Transcript: ENSMUST00000029194
AA Change: N3S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029194
Gene: ENSMUSG00000027660
AA Change: N3S

DomainStartEndE-ValueType
Pfam:Ski_Sno 121 233 2e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 419 437 N/A INTRINSIC
coiled coil region 526 670 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000117728
AA Change: N3S
SMART Domains Protein: ENSMUSP00000113054
Gene: ENSMUSG00000027660
AA Change: N3S

DomainStartEndE-ValueType
Pfam:Ski_Sno 41 153 1.5e-45 PFAM
c-SKI_SMAD_bind 178 273 6.01e-64 SMART
low complexity region 347 357 N/A INTRINSIC
coiled coil region 400 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118204
AA Change: N3S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112413
Gene: ENSMUSG00000027660
AA Change: N3S

DomainStartEndE-ValueType
Pfam:Ski_Sno 125 232 2.7e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 419 437 N/A INTRINSIC
coiled coil region 526 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118470
AA Change: N3S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113256
Gene: ENSMUSG00000027660
AA Change: N3S

DomainStartEndE-ValueType
Pfam:Ski_Sno 121 233 2e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 427 437 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123532
AA Change: N3S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123522
Gene: ENSMUSG00000027660
AA Change: N3S

DomainStartEndE-ValueType
Pfam:Ski_Sno 121 187 6.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144756
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of a small family of proteins that play a key role in the response of cells to extracellular growth signals. The encoded protein regulates members of the transforming growth factor beta signaling pathway. It is highly expressed in certain cancer cells, where it may have both tumor-suppressing and tumor-promoting roles. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Heterozygotes for a null allele develop lymphomas and show increased incidence of chemically-induced tumors while homozygotes die before implantation. Homozygotes for a different null allele are viable but show defective T cell activation and impaired mammary gland alveologenesis and lactogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Skil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01940:Skil APN 3 31111644 missense probably benign 0.01
IGL02149:Skil APN 3 31097707 missense possibly damaging 0.47
IGL02388:Skil APN 3 31111638 nonsense probably null
IGL02478:Skil APN 3 31097819 nonsense probably null
IGL02723:Skil APN 3 31117524 missense probably damaging 1.00
PIT4243001:Skil UTSW 3 31113565 missense probably damaging 0.98
PIT4466001:Skil UTSW 3 31098232 missense probably damaging 1.00
PIT4472001:Skil UTSW 3 31098232 missense probably damaging 1.00
R1809:Skil UTSW 3 31117506 missense probably damaging 0.99
R3750:Skil UTSW 3 31116834 missense probably benign 0.00
R4865:Skil UTSW 3 31113413 missense probably damaging 1.00
R5213:Skil UTSW 3 31117451 missense probably damaging 0.99
R5328:Skil UTSW 3 31117569 missense probably benign 0.00
R5357:Skil UTSW 3 31113551 missense probably benign
R5428:Skil UTSW 3 31097498 missense probably benign
R6153:Skil UTSW 3 31097853 missense probably damaging 1.00
R6613:Skil UTSW 3 31097880 missense probably null 1.00
R7270:Skil UTSW 3 31097175 intron probably benign
R7999:Skil UTSW 3 31097602 missense possibly damaging 0.90
Z1176:Skil UTSW 3 31097526 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GTACAGCTAAACCAAAACAGAGTTG -3'
(R):5'- TGCCAGCGTGTGTTTCAGAC -3'

Sequencing Primer
(F):5'- CTAAACCAAAACAGAGTTGTACAATC -3'
(R):5'- AAACACGGTTTCGCTTGGC -3'
Posted On2015-02-05