Incidental Mutation 'R3124:Trmt13'
ID264189
Institutional Source Beutler Lab
Gene Symbol Trmt13
Ensembl Gene ENSMUSG00000033439
Gene NametRNA methyltransferase 13
Synonyms
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116581093-116614587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116590244 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 104 (I104V)
Ref Sequence ENSEMBL: ENSMUSP00000138868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029571] [ENSMUST00000041524] [ENSMUST00000134761] [ENSMUST00000183638] [ENSMUST00000184963] [ENSMUST00000197190] [ENSMUST00000197335] [ENSMUST00000198311] [ENSMUST00000198386] [ENSMUST00000198454]
Predicted Effect probably benign
Transcript: ENSMUST00000029571
SMART Domains Protein: ENSMUSP00000029571
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:SAS-6_N 44 141 1.7e-29 PFAM
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041524
AA Change: I104V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047320
Gene: ENSMUSG00000033439
AA Change: I104V

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 17 45 7.2e-17 PFAM
Pfam:zf-U11-48K 56 80 3.4e-12 PFAM
Pfam:TRM13 165 469 7e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124807
Predicted Effect probably benign
Transcript: ENSMUST00000134761
SMART Domains Protein: ENSMUSP00000138761
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-U11-48K 16 42 1.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156161
Predicted Effect probably benign
Transcript: ENSMUST00000183638
AA Change: I104V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139223
Gene: ENSMUSG00000033439
AA Change: I104V

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 1.4e-17 PFAM
Pfam:zf-U11-48K 55 81 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184963
AA Change: I104V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138868
Gene: ENSMUSG00000033439
AA Change: I104V

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 2.9e-17 PFAM
Pfam:zf-U11-48K 55 81 2.3e-12 PFAM
Pfam:TRM13 165 285 3.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197190
AA Change: I55V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143637
Gene: ENSMUSG00000033439
AA Change: I55V

DomainStartEndE-ValueType
Pfam:TRM13 116 179 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197335
SMART Domains Protein: ENSMUSP00000143123
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
PDB:2Y3W|C 7 136 3e-48 PDB
low complexity region 188 200 N/A INTRINSIC
coiled coil region 380 436 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198311
SMART Domains Protein: ENSMUSP00000143233
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 9e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198386
SMART Domains Protein: ENSMUSP00000143175
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 1e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198454
SMART Domains Protein: ENSMUSP00000142410
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 1.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198514
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Trmt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Trmt13 APN 3 116590235 nonsense probably null
IGL01516:Trmt13 APN 3 116589810 unclassified probably benign
IGL01732:Trmt13 APN 3 116581464 missense probably damaging 1.00
IGL01783:Trmt13 APN 3 116582912 nonsense probably null
IGL02470:Trmt13 APN 3 116590228 critical splice donor site probably null
IGL02492:Trmt13 APN 3 116582543 missense possibly damaging 0.53
IGL02531:Trmt13 APN 3 116592191 critical splice donor site probably null
IGL03156:Trmt13 APN 3 116585802 missense probably benign 0.00
R0394:Trmt13 UTSW 3 116582650 missense probably damaging 1.00
R0446:Trmt13 UTSW 3 116582626 missense probably damaging 1.00
R2211:Trmt13 UTSW 3 116594754 missense probably benign 0.00
R2942:Trmt13 UTSW 3 116585772 missense probably damaging 1.00
R3945:Trmt13 UTSW 3 116581518 missense probably damaging 1.00
R3946:Trmt13 UTSW 3 116581518 missense probably damaging 1.00
R4255:Trmt13 UTSW 3 116582688 nonsense probably null
R4520:Trmt13 UTSW 3 116581613 splice site probably null
R4609:Trmt13 UTSW 3 116594827 utr 5 prime probably benign
R4678:Trmt13 UTSW 3 116589755 missense probably damaging 1.00
R4679:Trmt13 UTSW 3 116589755 missense probably damaging 1.00
R4703:Trmt13 UTSW 3 116594598 missense probably benign 0.00
R6526:Trmt13 UTSW 3 116592215 missense probably damaging 1.00
R7064:Trmt13 UTSW 3 116582697 missense probably damaging 1.00
R7079:Trmt13 UTSW 3 116582831 missense probably benign 0.00
R7308:Trmt13 UTSW 3 116594739 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGCTCACAACAGAGTCATTG -3'
(R):5'- TTGAGGCTGGGAAGTCATATTC -3'

Sequencing Primer
(F):5'- GCTCACAACAGAGTCATTGCAGTTG -3'
(R):5'- CTGGGAAGTCATATTCGGTGG -3'
Posted On2015-02-05