Incidental Mutation 'R3124:Nipsnap2'
List |< first << previous [record 20 of 38] next >> last >|
ID264191
Institutional Source Beutler Lab
Gene Symbol Nipsnap2
Ensembl Gene ENSMUSG00000029432
Gene Namenipsnap homolog 2
SynonymsGbas, Nipsnap2
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129725063-129758327 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 129748034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086046] [ENSMUST00000124342] [ENSMUST00000186265] [ENSMUST00000186265] [ENSMUST00000195946]
Predicted Effect probably null
Transcript: ENSMUST00000086046
SMART Domains Protein: ENSMUSP00000083211
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124342
SMART Domains Protein: ENSMUSP00000117705
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137604
Predicted Effect probably null
Transcript: ENSMUST00000186265
SMART Domains Protein: ENSMUSP00000141131
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186265
SMART Domains Protein: ENSMUSP00000141131
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195946
SMART Domains Protein: ENSMUSP00000142916
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. The encoded protein is localized to mitochondria and plays a role in oxidative phosphorylation. A pseudogene of this gene is located on the long arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Nipsnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Nipsnap2 APN 5 129754851 missense probably damaging 0.99
IGL01012:Nipsnap2 APN 5 129746439 missense possibly damaging 0.91
IGL01320:Nipsnap2 APN 5 129744764 missense probably damaging 1.00
IGL01321:Nipsnap2 APN 5 129757141 makesense probably null
IGL02119:Nipsnap2 APN 5 129747992 splice site probably benign
IGL02636:Nipsnap2 APN 5 129745290 intron probably benign
R0540:Nipsnap2 UTSW 5 129754845 missense probably damaging 1.00
R1497:Nipsnap2 UTSW 5 129753218 intron probably benign
R1649:Nipsnap2 UTSW 5 129753237 missense probably damaging 0.99
R1743:Nipsnap2 UTSW 5 129757085 missense probably damaging 1.00
R2020:Nipsnap2 UTSW 5 129753223 splice site probably null
R2187:Nipsnap2 UTSW 5 129746473 splice site probably null
R2215:Nipsnap2 UTSW 5 129739585 missense probably damaging 1.00
R2430:Nipsnap2 UTSW 5 129744791 missense possibly damaging 0.94
R5072:Nipsnap2 UTSW 5 129739580 missense probably damaging 1.00
R5150:Nipsnap2 UTSW 5 129757111 missense probably benign 0.03
R5823:Nipsnap2 UTSW 5 129739769 splice site probably null
R6736:Nipsnap2 UTSW 5 129745288 critical splice donor site probably null
R6913:Nipsnap2 UTSW 5 129753293 missense probably benign 0.11
R7163:Nipsnap2 UTSW 5 129744710 missense probably benign 0.00
R7597:Nipsnap2 UTSW 5 129739573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACCAGTGAGGATGGCTTC -3'
(R):5'- CTGAAGGAAGATTTACCTCGGC -3'

Sequencing Primer
(F):5'- TTCCCCTTGGGCTGTACGAAG -3'
(R):5'- GTTGAGGCACACACTTGTACATCAG -3'
Posted On2015-02-05