Incidental Mutation 'R3124:Pthlh'
List |< first << previous [record 24 of 38] next >> last >|
ID264194
Institutional Source Beutler Lab
Gene Symbol Pthlh
Ensembl Gene ENSMUSG00000048776
Gene Nameparathyroid hormone-like peptide
Synonymsparathyroid hormone-like hormone, PTH-related peptide, parathyroid hormone-related peptide, parathyroid hormone-related protein, PTH-like, Pthrp
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3124 (G1)
Quality Score224
Status Validated
Chromosome6
Chromosomal Location147252101-147264183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147263291 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 27 (V27E)
Ref Sequence ENSEMBL: ENSMUSP00000145509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052296] [ENSMUST00000204197]
Predicted Effect probably damaging
Transcript: ENSMUST00000052296
AA Change: V27E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051433
Gene: ENSMUSG00000048776
AA Change: V27E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204197
AA Change: V27E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145509
Gene: ENSMUSG00000048776
AA Change: V27E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Meta Mutation Damage Score 0.3418 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the parathyroid family of hormones that possesses distinct paracrine and intracrine signaling roles such as regulation of circulating calcium, transplacental calcium transport, osteoclast inhibition, renal bicarbonate excretion and regulation of apoptosis. The encoded protein undergoes proteolytic processing to generate multiple active peptides with distinct signaling functions. The homozygous deletion of this gene leads to death shortly after birth with a chondrodystrophic phenotype characterized by premature chondrocyte differentiation and accelerated bone formation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dischondroplasia associated with premature maturation of chondrocytes and die postnatally from asphyxia. Mutants rescued from neonatal lethality lack mammary development and tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Pthlh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Pthlh APN 6 147252575 missense probably benign 0.15
IGL02450:Pthlh APN 6 147257168 missense possibly damaging 0.95
R0847:Pthlh UTSW 6 147263268 critical splice donor site probably null
R2171:Pthlh UTSW 6 147257196 missense probably damaging 1.00
R2174:Pthlh UTSW 6 147257012 missense probably benign 0.00
R3123:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R3125:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R4660:Pthlh UTSW 6 147257298 missense probably damaging 1.00
R5234:Pthlh UTSW 6 147257094 missense probably damaging 1.00
R5244:Pthlh UTSW 6 147257153 missense probably damaging 1.00
R5809:Pthlh UTSW 6 147257247 missense probably damaging 0.99
R6475:Pthlh UTSW 6 147257190 missense probably damaging 0.98
R7548:Pthlh UTSW 6 147257155 missense possibly damaging 0.56
Z1177:Pthlh UTSW 6 147263342 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTCCATTTTGGGGTCTCAC -3'
(R):5'- AAGCCACGGGGTTCCAAAAG -3'

Sequencing Primer
(F):5'- GGGTCTCACCAGCTCTCTAGATG -3'
(R):5'- TTCCAAAAGAGGGAGCGGG -3'
Posted On2015-02-05