Incidental Mutation 'R3124:Vmn1r87'
List |< first << previous [record 37 of 38] next >> last >|
ID264195
Institutional Source Beutler Lab
Gene Symbol Vmn1r87
Ensembl Gene ENSMUSG00000070815
Gene Namevomeronasal 1 receptor 87
SynonymsV1rk1
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13130904-13140157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13131566 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 265 (Y265H)
Ref Sequence ENSEMBL: ENSMUSP00000154184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094827] [ENSMUST00000211249] [ENSMUST00000227443] [ENSMUST00000228800]
Predicted Effect probably damaging
Transcript: ENSMUST00000094827
AA Change: Y265H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092422
Gene: ENSMUSG00000070815
AA Change: Y265H

DomainStartEndE-ValueType
Pfam:TAS2R 1 285 1.2e-11 PFAM
Pfam:V1R 14 280 1.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211249
AA Change: Y265H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227443
AA Change: Y265H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228800
AA Change: Y265H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Vmn1r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Vmn1r87 APN 7 13132303 missense probably damaging 1.00
IGL01577:Vmn1r87 APN 7 13131848 missense probably benign 0.00
IGL02972:Vmn1r87 APN 7 13132329 nonsense probably null
IGL03246:Vmn1r87 APN 7 13132361 utr 5 prime probably benign
PIT4142001:Vmn1r87 UTSW 7 13132185 missense probably benign 0.00
R0153:Vmn1r87 UTSW 7 13132284 missense probably damaging 1.00
R0502:Vmn1r87 UTSW 7 13131656 missense probably damaging 1.00
R0658:Vmn1r87 UTSW 7 13131829 missense probably damaging 1.00
R1589:Vmn1r87 UTSW 7 13131776 missense possibly damaging 0.46
R1731:Vmn1r87 UTSW 7 13131776 missense possibly damaging 0.46
R2027:Vmn1r87 UTSW 7 13131896 missense probably damaging 0.99
R2044:Vmn1r87 UTSW 7 13131821 missense probably benign 0.02
R4208:Vmn1r87 UTSW 7 13132258 missense probably benign 0.37
R4731:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R4732:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R4733:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R5079:Vmn1r87 UTSW 7 13132326 missense probably benign 0.01
R5125:Vmn1r87 UTSW 7 13131865 missense possibly damaging 0.79
R5178:Vmn1r87 UTSW 7 13131865 missense possibly damaging 0.79
R6599:Vmn1r87 UTSW 7 13131959 nonsense probably null
R7067:Vmn1r87 UTSW 7 13131922 missense probably benign 0.02
R7560:Vmn1r87 UTSW 7 13131818 missense probably damaging 1.00
R7574:Vmn1r87 UTSW 7 13131686 missense probably benign 0.01
R7910:Vmn1r87 UTSW 7 13131905 missense probably damaging 1.00
R7991:Vmn1r87 UTSW 7 13131905 missense probably damaging 1.00
R8040:Vmn1r87 UTSW 7 13132159 missense possibly damaging 0.87
X0028:Vmn1r87 UTSW 7 13131983 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTGGATATTATATACTCAGGCATGC -3'
(R):5'- TAGGAGTACACGGCATGTCCAC -3'

Sequencing Primer
(F):5'- CATGCTATGGCTATTTTGCTCATG -3'
(R):5'- ACGGCATGTCCACAGTTTCAG -3'
Posted On2015-02-05