Incidental Mutation 'R3124:Zfp574'
List |< first << previous [record 38 of 38]
ID264196
Institutional Source Beutler Lab
Gene Symbol Zfp574
Ensembl Gene ENSMUSG00000045252
Gene Namezinc finger protein 574
SynonymsA630056B21Rik
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R3124 (G1)
Quality Score139
Status Validated
Chromosome7
Chromosomal Location25072567-25083492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25081601 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 683 (A683S)
Ref Sequence ENSEMBL: ENSMUSP00000136547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053410] [ENSMUST00000179556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053410
AA Change: A683S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057817
Gene: ENSMUSG00000045252
AA Change: A683S

DomainStartEndE-ValueType
ZnF_C2H2 16 38 4.98e-1 SMART
ZnF_C2H2 76 98 4.05e-1 SMART
low complexity region 107 118 N/A INTRINSIC
ZnF_C2H2 126 148 1.99e0 SMART
low complexity region 156 173 N/A INTRINSIC
ZnF_C2H2 213 235 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
ZnF_C2H2 312 334 7.15e-2 SMART
ZnF_C2H2 339 361 1.04e-3 SMART
ZnF_C2H2 367 389 4.12e0 SMART
ZnF_C2H2 395 416 2.12e1 SMART
low complexity region 418 434 N/A INTRINSIC
ZnF_C2H2 469 492 1.03e-2 SMART
ZnF_C2H2 498 520 2.75e-3 SMART
ZnF_C2H2 526 548 3.39e-3 SMART
ZnF_C2H2 554 576 2.75e-3 SMART
ZnF_C2H2 582 604 2.86e-1 SMART
ZnF_C2H2 610 633 1.25e-1 SMART
ZnF_C2H2 639 659 4.5e1 SMART
low complexity region 660 666 N/A INTRINSIC
ZnF_C2H2 670 692 2.29e0 SMART
ZnF_C2H2 742 764 2.91e-2 SMART
ZnF_C2H2 770 792 5.59e-4 SMART
ZnF_C2H2 798 820 3.34e-2 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179556
AA Change: A683S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136547
Gene: ENSMUSG00000045252
AA Change: A683S

DomainStartEndE-ValueType
ZnF_C2H2 16 38 4.98e-1 SMART
ZnF_C2H2 76 98 4.05e-1 SMART
low complexity region 107 118 N/A INTRINSIC
ZnF_C2H2 126 148 1.99e0 SMART
low complexity region 156 173 N/A INTRINSIC
ZnF_C2H2 213 235 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
ZnF_C2H2 312 334 7.15e-2 SMART
ZnF_C2H2 339 361 1.04e-3 SMART
ZnF_C2H2 367 389 4.12e0 SMART
ZnF_C2H2 395 416 2.12e1 SMART
low complexity region 418 434 N/A INTRINSIC
ZnF_C2H2 469 492 1.03e-2 SMART
ZnF_C2H2 498 520 2.75e-3 SMART
ZnF_C2H2 526 548 3.39e-3 SMART
ZnF_C2H2 554 576 2.75e-3 SMART
ZnF_C2H2 582 604 2.86e-1 SMART
ZnF_C2H2 610 633 1.25e-1 SMART
ZnF_C2H2 639 659 4.5e1 SMART
low complexity region 660 666 N/A INTRINSIC
ZnF_C2H2 670 692 2.29e0 SMART
ZnF_C2H2 742 764 2.91e-2 SMART
ZnF_C2H2 770 792 5.59e-4 SMART
ZnF_C2H2 798 820 3.34e-2 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206733
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Other mutations in Zfp574
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zfp574 APN 7 25081590 missense probably benign 0.00
IGL02370:Zfp574 APN 7 25079589 missense possibly damaging 0.95
IGL02706:Zfp574 APN 7 25081365 missense probably damaging 0.98
IGL03119:Zfp574 APN 7 25080473 missense probably benign
glue UTSW 7 25081090 missense probably damaging 0.98
R0866:Zfp574 UTSW 7 25079898 missense probably damaging 1.00
R2429:Zfp574 UTSW 7 25080057 nonsense probably null
R3123:Zfp574 UTSW 7 25081601 missense possibly damaging 0.88
R3125:Zfp574 UTSW 7 25081601 missense possibly damaging 0.88
R4581:Zfp574 UTSW 7 25081313 missense probably damaging 0.98
R4591:Zfp574 UTSW 7 25079544 start gained probably benign
R4915:Zfp574 UTSW 7 25080726 missense probably damaging 0.98
R4953:Zfp574 UTSW 7 25080963 missense probably damaging 0.97
R5305:Zfp574 UTSW 7 25081090 missense probably damaging 0.98
R5541:Zfp574 UTSW 7 25081950 missense probably damaging 0.99
R5934:Zfp574 UTSW 7 25080332 missense probably benign
R6088:Zfp574 UTSW 7 25080339 missense probably benign 0.01
R7061:Zfp574 UTSW 7 25080197 missense possibly damaging 0.95
R7563:Zfp574 UTSW 7 25081352 missense possibly damaging 0.94
R7615:Zfp574 UTSW 7 25080576 missense possibly damaging 0.95
R8019:Zfp574 UTSW 7 25080670 nonsense probably null
X0026:Zfp574 UTSW 7 25081052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACCAGCTTGTGATCCATG -3'
(R):5'- TGGACCTGTAGTGACGTCTC -3'

Sequencing Primer
(F):5'- CTTGTGATCCATGCTGGGC -3'
(R):5'- GAAGAGCTTCTTGCACTCACTG -3'
Posted On2015-02-05