Incidental Mutation 'R3124:Tnpo1'
List |< first << previous [record 30 of 38] next >> last >|
ID264208
Institutional Source Beutler Lab
Gene Symbol Tnpo1
Ensembl Gene ENSMUSG00000009470
Gene Nametransportin 1
SynonymsKpnb2, D13Ertd688e
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R3124 (G1)
Quality Score138
Status Validated
Chromosome13
Chromosomal Location98839019-98926384 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC at 98867129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109399] [ENSMUST00000109401] [ENSMUST00000179301]
Predicted Effect probably null
Transcript: ENSMUST00000109399
SMART Domains Protein: ENSMUSP00000105026
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.7e-12 PFAM
Pfam:HEAT 439 469 6.8e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109401
SMART Domains Protein: ENSMUSP00000105028
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 41 109 1.53e-6 SMART
low complexity region 358 376 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Pfam:HEAT_EZ 419 473 6.6e-15 PFAM
Pfam:HEAT 447 477 1.3e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179301
SMART Domains Protein: ENSMUSP00000136917
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.2e-12 PFAM
Pfam:HEAT 439 469 6.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224099
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the karyopherin receptor complex which interacts with nuclear localization signals to target nuclear proteins to the nucleus. The karyopherin receptor complex is a heterodimer of an alpha subunit which recognizes the nuclear localization signal and a beta subunit which docks the complex at nucleoporins. Alternate splicing of this gene results in two transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Tnpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Tnpo1 APN 13 98850104 splice site probably benign
IGL02572:Tnpo1 APN 13 98849159 missense probably damaging 1.00
IGL03040:Tnpo1 APN 13 98859955 missense probably damaging 0.99
IGL03237:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03379:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03393:Tnpo1 APN 13 98888473 missense probably damaging 0.99
IGL03405:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03407:Tnpo1 APN 13 98863840 missense probably damaging 0.98
Domineight UTSW 13 98867129 frame shift probably null
invert UTSW 13 98855446 missense probably damaging 1.00
R0308:Tnpo1 UTSW 13 98846503 missense probably damaging 0.97
R0465:Tnpo1 UTSW 13 98884634 missense probably damaging 0.97
R0492:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0707:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0732:Tnpo1 UTSW 13 98863812 missense probably damaging 0.99
R1314:Tnpo1 UTSW 13 98860722 missense probably damaging 0.99
R1449:Tnpo1 UTSW 13 98878712 missense probably damaging 0.99
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1488:Tnpo1 UTSW 13 98856907 missense probably damaging 0.98
R1961:Tnpo1 UTSW 13 98852932 missense probably damaging 1.00
R3123:Tnpo1 UTSW 13 98867129 frame shift probably null
R4151:Tnpo1 UTSW 13 98852899 missense probably damaging 1.00
R4272:Tnpo1 UTSW 13 98867129 frame shift probably null
R4274:Tnpo1 UTSW 13 98867129 frame shift probably null
R5154:Tnpo1 UTSW 13 98870305 missense possibly damaging 0.84
R5763:Tnpo1 UTSW 13 98859937 missense possibly damaging 0.54
R5765:Tnpo1 UTSW 13 98859841 missense probably benign 0.08
R5827:Tnpo1 UTSW 13 98856908 missense probably damaging 1.00
R6240:Tnpo1 UTSW 13 98863829 missense probably damaging 1.00
R6279:Tnpo1 UTSW 13 98890708 missense possibly damaging 0.90
R6294:Tnpo1 UTSW 13 98890774 missense probably benign 0.03
R7055:Tnpo1 UTSW 13 98855479 missense possibly damaging 0.85
R7509:Tnpo1 UTSW 13 98870243 missense probably benign 0.00
R7707:Tnpo1 UTSW 13 98890787 missense probably benign 0.00
Z1088:Tnpo1 UTSW 13 98860670 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGATGAGCAAAACCTAGTCTCTATG -3'
(R):5'- CCCCAGATGTGTATGTGCAC -3'

Sequencing Primer
(F):5'- GTTTAAATAATTCCTCCACCGGGCAG -3'
(R):5'- TGTATGTGCACAAAGGAGTTCC -3'
Posted On2015-02-05