Incidental Mutation 'R3124:Mcpt8'
ID264209
Institutional Source Beutler Lab
Gene Symbol Mcpt8
Ensembl Gene ENSMUSG00000022157
Gene Namemast cell protease 8
SynonymsMMCP-8
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56082166-56085273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56083941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 22 (I22K)
Ref Sequence ENSEMBL: ENSMUSP00000015594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015594] [ENSMUST00000225107]
Predicted Effect probably damaging
Transcript: ENSMUST00000015594
AA Change: I22K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015594
Gene: ENSMUSG00000022157
AA Change: I22K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 237 1.65e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184701
Predicted Effect possibly damaging
Transcript: ENSMUST00000225107
AA Change: I22K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in mutation that allows diphtheria toxin-mediated basophil depletion before the second tick infestation exhibit loss of acquired tick resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Mcpt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mcpt8 APN 14 56083945 missense probably damaging 1.00
IGL01960:Mcpt8 APN 14 56082407 splice site probably null
R0973:Mcpt8 UTSW 14 56083800 splice site probably benign
R1472:Mcpt8 UTSW 14 56082334 missense probably benign 0.02
R1908:Mcpt8 UTSW 14 56083834 missense probably benign 0.03
R2131:Mcpt8 UTSW 14 56082283 missense probably damaging 1.00
R3123:Mcpt8 UTSW 14 56083941 missense probably damaging 0.98
R3125:Mcpt8 UTSW 14 56083941 missense probably damaging 0.98
R4209:Mcpt8 UTSW 14 56083918 missense probably damaging 1.00
R4211:Mcpt8 UTSW 14 56083918 missense probably damaging 1.00
R4658:Mcpt8 UTSW 14 56083828 missense possibly damaging 0.46
R4860:Mcpt8 UTSW 14 56082280 missense probably benign 0.02
R4860:Mcpt8 UTSW 14 56082280 missense probably benign 0.02
R5457:Mcpt8 UTSW 14 56082336 missense probably benign 0.04
R5900:Mcpt8 UTSW 14 56082283 missense probably damaging 1.00
R6334:Mcpt8 UTSW 14 56085147 missense possibly damaging 0.90
R6339:Mcpt8 UTSW 14 56082337 missense probably benign 0.00
R7505:Mcpt8 UTSW 14 56083091 missense probably benign 0.05
Z1177:Mcpt8 UTSW 14 56082336 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTTAGGGACAGCCAGGATC -3'
(R):5'- TTTGTGTGATCTCTCGCAGC -3'

Sequencing Primer
(F):5'- TTGGTTAGTCCCAGGCATCAAAG -3'
(R):5'- TGATCTCTCGCAGCACCCAG -3'
Posted On2015-02-05