Incidental Mutation 'R3124:Pet2'
List |< first << previous [record 22 of 38] next >> last >|
ID264217
Institutional Source Beutler Lab
Gene Symbol Pet2
Ensembl Gene ENSMUSG00000035395
Gene Nameplasmacytoma expressed transcript 2
SynonymsPC326, PC231, Pex3
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R3124 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location89403848-89409689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89404721 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 601 (Y601N)
Ref Sequence ENSEMBL: ENSMUSP00000109593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113959] [ENSMUST00000113960]
Predicted Effect probably benign
Transcript: ENSMUST00000113959
AA Change: Y601N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109592
Gene: ENSMUSG00000035395
AA Change: Y601N

DomainStartEndE-ValueType
low complexity region 80 96 N/A INTRINSIC
low complexity region 144 153 N/A INTRINSIC
low complexity region 180 192 N/A INTRINSIC
low complexity region 202 217 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
WD40 342 381 2.67e-9 SMART
WD40 384 426 8.91e-1 SMART
Blast:WD40 432 472 4e-19 BLAST
WD40 478 520 1.65e1 SMART
WD40 535 575 7.4e0 SMART
WD40 581 623 1.28e0 SMART
WD40 626 666 2.61e-3 SMART
low complexity region 729 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113960
AA Change: Y601N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109593
Gene: ENSMUSG00000035395
AA Change: Y601N

DomainStartEndE-ValueType
low complexity region 80 96 N/A INTRINSIC
low complexity region 144 153 N/A INTRINSIC
low complexity region 180 192 N/A INTRINSIC
low complexity region 202 217 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
WD40 342 381 2.67e-9 SMART
WD40 384 426 8.91e-1 SMART
Blast:WD40 432 472 4e-19 BLAST
WD40 478 520 1.65e1 SMART
WD40 535 575 7.4e0 SMART
WD40 581 623 1.28e0 SMART
WD40 626 666 2.61e-3 SMART
low complexity region 729 740 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Pet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Pet2 APN X 89406338 missense possibly damaging 0.86
IGL03064:Pet2 APN X 89405251 missense possibly damaging 0.95
R0401:Pet2 UTSW X 89405209 missense probably benign 0.01
R0612:Pet2 UTSW X 89405366 nonsense probably null
R2146:Pet2 UTSW X 89406277 missense possibly damaging 0.85
R2148:Pet2 UTSW X 89406277 missense possibly damaging 0.85
R3123:Pet2 UTSW X 89404721 missense probably benign 0.01
R3125:Pet2 UTSW X 89404721 missense probably benign 0.01
Z1088:Pet2 UTSW X 89406337 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CATTCTTTAAGCCGGCAAGC -3'
(R):5'- TTAGCTCTGATTACCCAGCACAC -3'

Sequencing Primer
(F):5'- TCATGGTCTAGCCCACTGGATG -3'
(R):5'- TTACCCAGCACACATCACATCTCTG -3'
Posted On2015-02-05