Incidental Mutation 'R3125:Hsd17b12'
ID264222
Institutional Source Beutler Lab
Gene Symbol Hsd17b12
Ensembl Gene ENSMUSG00000027195
Gene Namehydroxysteroid (17-beta) dehydrogenase 12
Synonymskeratonectin, keratoadhesin, 2610510O05Rik, KIK-I
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location94032689-94157964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94033958 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 268 (R268Q)
Ref Sequence ENSEMBL: ENSMUSP00000028619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028619]
Predicted Effect probably benign
Transcript: ENSMUST00000028619
AA Change: R268Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028619
Gene: ENSMUSG00000027195
AA Change: R268Q

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:adh_short 51 248 1.5e-46 PFAM
Pfam:KR 52 125 4.4e-7 PFAM
Pfam:adh_short_C2 57 277 7.5e-10 PFAM
low complexity region 298 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146580
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit die around E8.5 with abnormal embryonic and extraembryonic tissue development. ES cells heterozygous for this allele exhibit reduced arachidonic acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Hsd17b12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Hsd17b12 APN 2 94083165 critical splice donor site probably null
IGL00785:Hsd17b12 APN 2 94045414 missense probably damaging 1.00
IGL02230:Hsd17b12 APN 2 94045398 missense possibly damaging 0.94
IGL02635:Hsd17b12 APN 2 94083211 missense possibly damaging 0.93
IGL03094:Hsd17b12 APN 2 94033994 missense probably damaging 1.00
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0390:Hsd17b12 UTSW 2 94114990 splice site probably benign
R0552:Hsd17b12 UTSW 2 94043935 missense probably damaging 1.00
R0605:Hsd17b12 UTSW 2 94033642 missense probably benign 0.00
R1585:Hsd17b12 UTSW 2 94033976 missense probably damaging 1.00
R1681:Hsd17b12 UTSW 2 94033561 missense unknown
R1922:Hsd17b12 UTSW 2 94045392 missense probably benign 0.00
R2190:Hsd17b12 UTSW 2 94034063 missense probably benign 0.02
R2384:Hsd17b12 UTSW 2 94033619 missense probably benign
R3123:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3124:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R4283:Hsd17b12 UTSW 2 94033586 missense unknown
R5218:Hsd17b12 UTSW 2 94083263 missense probably benign 0.02
R5357:Hsd17b12 UTSW 2 94033645 missense possibly damaging 0.47
R6020:Hsd17b12 UTSW 2 94033977 missense probably damaging 1.00
R6493:Hsd17b12 UTSW 2 94043883 missense probably damaging 1.00
R7792:Hsd17b12 UTSW 2 94033641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTATCTGCCACCTTC -3'
(R):5'- CCTTCCTAATCAATGGCATGTG -3'

Sequencing Primer
(F):5'- AAAGCCTATCTGCCACCTTCTAATTC -3'
(R):5'- CCTAATCAATGGCATGTGTTGTC -3'
Posted On2015-02-05