Incidental Mutation 'R3125:Zfp574'
ID264235
Institutional Source Beutler Lab
Gene Symbol Zfp574
Ensembl Gene ENSMUSG00000045252
Gene Namezinc finger protein 574
SynonymsA630056B21Rik
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25072567-25083492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25081601 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 683 (A683S)
Ref Sequence ENSEMBL: ENSMUSP00000136547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053410] [ENSMUST00000179556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053410
AA Change: A683S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057817
Gene: ENSMUSG00000045252
AA Change: A683S

DomainStartEndE-ValueType
ZnF_C2H2 16 38 4.98e-1 SMART
ZnF_C2H2 76 98 4.05e-1 SMART
low complexity region 107 118 N/A INTRINSIC
ZnF_C2H2 126 148 1.99e0 SMART
low complexity region 156 173 N/A INTRINSIC
ZnF_C2H2 213 235 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
ZnF_C2H2 312 334 7.15e-2 SMART
ZnF_C2H2 339 361 1.04e-3 SMART
ZnF_C2H2 367 389 4.12e0 SMART
ZnF_C2H2 395 416 2.12e1 SMART
low complexity region 418 434 N/A INTRINSIC
ZnF_C2H2 469 492 1.03e-2 SMART
ZnF_C2H2 498 520 2.75e-3 SMART
ZnF_C2H2 526 548 3.39e-3 SMART
ZnF_C2H2 554 576 2.75e-3 SMART
ZnF_C2H2 582 604 2.86e-1 SMART
ZnF_C2H2 610 633 1.25e-1 SMART
ZnF_C2H2 639 659 4.5e1 SMART
low complexity region 660 666 N/A INTRINSIC
ZnF_C2H2 670 692 2.29e0 SMART
ZnF_C2H2 742 764 2.91e-2 SMART
ZnF_C2H2 770 792 5.59e-4 SMART
ZnF_C2H2 798 820 3.34e-2 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179556
AA Change: A683S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136547
Gene: ENSMUSG00000045252
AA Change: A683S

DomainStartEndE-ValueType
ZnF_C2H2 16 38 4.98e-1 SMART
ZnF_C2H2 76 98 4.05e-1 SMART
low complexity region 107 118 N/A INTRINSIC
ZnF_C2H2 126 148 1.99e0 SMART
low complexity region 156 173 N/A INTRINSIC
ZnF_C2H2 213 235 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
ZnF_C2H2 312 334 7.15e-2 SMART
ZnF_C2H2 339 361 1.04e-3 SMART
ZnF_C2H2 367 389 4.12e0 SMART
ZnF_C2H2 395 416 2.12e1 SMART
low complexity region 418 434 N/A INTRINSIC
ZnF_C2H2 469 492 1.03e-2 SMART
ZnF_C2H2 498 520 2.75e-3 SMART
ZnF_C2H2 526 548 3.39e-3 SMART
ZnF_C2H2 554 576 2.75e-3 SMART
ZnF_C2H2 582 604 2.86e-1 SMART
ZnF_C2H2 610 633 1.25e-1 SMART
ZnF_C2H2 639 659 4.5e1 SMART
low complexity region 660 666 N/A INTRINSIC
ZnF_C2H2 670 692 2.29e0 SMART
ZnF_C2H2 742 764 2.91e-2 SMART
ZnF_C2H2 770 792 5.59e-4 SMART
ZnF_C2H2 798 820 3.34e-2 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206733
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Other mutations in Zfp574
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zfp574 APN 7 25081590 missense probably benign 0.00
IGL02370:Zfp574 APN 7 25079589 missense possibly damaging 0.95
IGL02706:Zfp574 APN 7 25081365 missense probably damaging 0.98
IGL03119:Zfp574 APN 7 25080473 missense probably benign
glue UTSW 7 25081090 missense probably damaging 0.98
BB004:Zfp574 UTSW 7 25080147 missense probably benign
BB014:Zfp574 UTSW 7 25080147 missense probably benign
R0866:Zfp574 UTSW 7 25079898 missense probably damaging 1.00
R2429:Zfp574 UTSW 7 25080057 nonsense probably null
R3123:Zfp574 UTSW 7 25081601 missense possibly damaging 0.88
R3124:Zfp574 UTSW 7 25081601 missense possibly damaging 0.88
R4581:Zfp574 UTSW 7 25081313 missense probably damaging 0.98
R4591:Zfp574 UTSW 7 25079544 start gained probably benign
R4915:Zfp574 UTSW 7 25080726 missense probably damaging 0.98
R4953:Zfp574 UTSW 7 25080963 missense probably damaging 0.97
R5305:Zfp574 UTSW 7 25081090 missense probably damaging 0.98
R5541:Zfp574 UTSW 7 25081950 missense probably damaging 0.99
R5934:Zfp574 UTSW 7 25080332 missense probably benign
R6088:Zfp574 UTSW 7 25080339 missense probably benign 0.01
R7061:Zfp574 UTSW 7 25080197 missense possibly damaging 0.95
R7563:Zfp574 UTSW 7 25081352 missense possibly damaging 0.94
R7615:Zfp574 UTSW 7 25080576 missense possibly damaging 0.95
R7927:Zfp574 UTSW 7 25080147 missense probably benign
R8017:Zfp574 UTSW 7 25080670 nonsense probably null
R8019:Zfp574 UTSW 7 25080670 nonsense probably null
X0026:Zfp574 UTSW 7 25081052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTCCACCAGCTTGTGATC -3'
(R):5'- ACCTGTAGTGACGTCTCTGTG -3'

Sequencing Primer
(F):5'- ACCAGCTTGTGATCCATGC -3'
(R):5'- GAAGAGCTTCTTGCACTCACTG -3'
Posted On2015-02-05