Mutagenetix > Incidental Mutation

Incidental Mutation 'R3125:Atp4a'

264237

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

040598-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R3125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30720225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 671 (R671Q)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005692
AA Change: R671Q

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: R671Q

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably benign
Transcript: ENSMUST00000170371
AA Change: R671Q

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: R671Q

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	T	6: 116,427,137		probably null	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Cep135	T	C	5: 76,621,363		probably null	Het
Cfap206	T	A	4: 34,716,310	H385L	possibly damaging	Het
Dach2	T	C	X: 113,819,967	I417T	possibly damaging	Het
Dhx32	T	C	7: 133,725,356	Y332C	probably damaging	Het
Dlx1	T	A	2: 71,532,396	W216R	probably damaging	Het
Dna2	G	A	10: 62,949,202	A33T	possibly damaging	Het
Doxl2	A	T	6: 48,975,371	I77F	probably damaging	Het
Dyrk1a	G	A	16: 94,668,801		probably benign	Het
Fam227b	T	C	2: 126,124,086	T140A	probably benign	Het
Fem1b	T	C	9: 62,796,554	I475V	probably benign	Het
Fign	T	A	2: 63,978,700	Q742L	possibly damaging	Het
Hip1r	A	G	5: 124,000,141	D766G	probably benign	Het
Hsd17b12	C	T	2: 94,033,958	R268Q	probably benign	Het
Htt	T	C	5: 34,804,531	S287P	probably benign	Het
Icam5	A	G	9: 21,036,658	I617M	probably benign	Het
Ifi27l2b	T	C	12: 103,451,335	T198A	unknown	Het
Ip6k3	T	C	17: 27,157,542	Y65C	probably damaging	Het
Kif15	A	C	9: 122,987,961	Q542P	probably damaging	Het
Kit	G	T	5: 75,647,827	A744S	probably benign	Het
Kit	C	T	5: 75,647,828	A744V	probably null	Het
Lonp1	A	G	17: 56,626,488	I129T	possibly damaging	Het
Ltbp4	C	T	7: 27,327,778	R389Q	possibly damaging	Het
Map3k21	A	T	8: 125,941,854	K726N	probably benign	Het
Mcpt8	A	T	14: 56,083,941	I22K	probably damaging	Het
Npb	G	A	11: 120,608,902	V103I	possibly damaging	Het
Olfr131	G	A	17: 38,082,012		probably null	Het
Olfr535	T	C	7: 140,492,851	M71T	probably benign	Het
Pet2	A	T	X: 89,404,721	Y601N	probably benign	Het
Plin2	G	T	4: 86,657,144	Y389*	probably null	Het
Pnpla6	G	T	8: 3,534,670	G763C	probably null	Het
Pnpla7	A	G	2: 25,042,138	D935G	probably damaging	Het
Prr29	A	G	11: 106,374,885	S10G	probably benign	Het
Pthlh	A	T	6: 147,263,291	V27E	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Serpina12	G	A	12: 104,037,983	T130I	probably benign	Het
Slc6a18	A	G	13: 73,677,802	F43S	probably damaging	Het
Stx6	C	T	1: 155,158,908	P6S	probably damaging	Het
Togaram1	G	T	12: 64,966,344	R123L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim9	C	T	12: 70,248,393	G648R	probably damaging	Het
Trpm2	T	A	10: 77,911,374	N1430I	probably damaging	Het
Trpm6	C	G	19: 18,854,431	H1553Q	probably benign	Het
Vav3	G	A	3: 109,628,168		probably null	Het
Zfp574	G	T	7: 25,081,601	A683S	possibly damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGCGTGGGTATCATCTCAGAG -3'
(R):5'- CCATGGTTAGAAAGACAGCCCC -3'

Sequencing Primer
(F):5'- TATCATCTCAGAGGGCAGCG -3'
(R):5'- GACAGCCCAGCCCATCTG -3'

Posted On

2015-02-05