Incidental Mutation 'R3125:Dhx32'
ID264238
Institutional Source Beutler Lab
Gene Symbol Dhx32
Ensembl Gene ENSMUSG00000030986
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 32
SynonymsDdx32
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location133720942-133782726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133725356 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 332 (Y332C)
Ref Sequence ENSEMBL: ENSMUSP00000101745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033282] [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139]
Predicted Effect probably benign
Transcript: ENSMUST00000033282
SMART Domains Protein: ENSMUSP00000033282
Gene: ENSMUSG00000030983

DomainStartEndE-ValueType
Pfam:BCIP 58 258 2.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000033290
AA Change: Y472C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986
AA Change: Y472C

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063669
AA Change: Y472C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986
AA Change: Y472C

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106139
AA Change: Y332C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986
AA Change: Y332C

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151711
Meta Mutation Damage Score 0.6866 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Dhx32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Dhx32 APN 7 133748977 missense possibly damaging 0.76
IGL03398:Dhx32 APN 7 133759525 missense probably damaging 1.00
R0729:Dhx32 UTSW 7 133737421 missense probably benign 0.01
R1054:Dhx32 UTSW 7 133725272 missense probably damaging 1.00
R1438:Dhx32 UTSW 7 133737340 missense possibly damaging 0.87
R1532:Dhx32 UTSW 7 133749024 missense possibly damaging 0.93
R1864:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R1865:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R2074:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2075:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2119:Dhx32 UTSW 7 133722247 nonsense probably null
R2377:Dhx32 UTSW 7 133724478 missense probably damaging 1.00
R4519:Dhx32 UTSW 7 133734109 missense probably damaging 1.00
R4970:Dhx32 UTSW 7 133738655 intron probably benign
R5538:Dhx32 UTSW 7 133723217 missense probably benign
R5616:Dhx32 UTSW 7 133721228 makesense probably null
R5951:Dhx32 UTSW 7 133737328 missense probably damaging 0.98
R6081:Dhx32 UTSW 7 133722212 missense probably damaging 1.00
R6297:Dhx32 UTSW 7 133742800 missense probably damaging 1.00
R6319:Dhx32 UTSW 7 133737226 missense probably damaging 1.00
R7088:Dhx32 UTSW 7 133742688 missense probably damaging 1.00
R7257:Dhx32 UTSW 7 133759477 missense probably benign 0.08
R7686:Dhx32 UTSW 7 133759701 start codon destroyed probably null
R8025:Dhx32 UTSW 7 133721371 missense probably damaging 1.00
R8255:Dhx32 UTSW 7 133737391 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTACGTGCTGTGGATTCAC -3'
(R):5'- TGTACCCTGTCAGCCTCAGAAG -3'

Sequencing Primer
(F):5'- TTCACAGTACCTAGAGAGAAAGGTC -3'
(R):5'- TGTCAGCCTCAGAAGCTACG -3'
Posted On2015-02-05