Incidental Mutation 'R3125:Olfr535'
ID264239
Institutional Source Beutler Lab
Gene Symbol Olfr535
Ensembl Gene ENSMUSG00000063230
Gene Nameolfactory receptor 535
SynonymsGA_x6K02T2PBJ9-42641642-42642574, MOR253-7
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140484216-140497104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140492851 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 71 (M71T)
Ref Sequence ENSEMBL: ENSMUSP00000149412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074897] [ENSMUST00000213715] [ENSMUST00000214296] [ENSMUST00000216585] [ENSMUST00000217235] [ENSMUST00000217580]
Predicted Effect probably benign
Transcript: ENSMUST00000074897
AA Change: M71T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000074435
Gene: ENSMUSG00000063230
AA Change: M71T

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 4.5e-50 PFAM
Pfam:7TM_GPCR_Srsx 37 183 1.1e-8 PFAM
Pfam:7tm_1 43 292 5.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213339
Predicted Effect probably benign
Transcript: ENSMUST00000213715
AA Change: M71T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000214296
AA Change: M71T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000216585
AA Change: M71T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216962
Predicted Effect probably benign
Transcript: ENSMUST00000217235
AA Change: M71T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000217580
AA Change: M71T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.1938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Olfr535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Olfr535 APN 7 140492701 missense probably benign 0.00
IGL01537:Olfr535 APN 7 140492838 missense probably damaging 1.00
IGL01639:Olfr535 APN 7 140493186 missense probably benign 0.09
IGL02157:Olfr535 APN 7 140492934 missense probably damaging 1.00
IGL02593:Olfr535 APN 7 140493331 missense probably benign 0.04
IGL03108:Olfr535 APN 7 140493121 missense possibly damaging 0.50
R1835:Olfr535 UTSW 7 140492709 missense probably benign
R2040:Olfr535 UTSW 7 140493382 missense probably benign 0.10
R4795:Olfr535 UTSW 7 140493007 missense probably damaging 1.00
R6187:Olfr535 UTSW 7 140492616 start gained probably benign
R6285:Olfr535 UTSW 7 140492713 missense possibly damaging 0.71
R6528:Olfr535 UTSW 7 140493051 missense probably damaging 1.00
R7016:Olfr535 UTSW 7 140493240 missense probably benign 0.01
R7573:Olfr535 UTSW 7 140492999 missense probably damaging 1.00
R7867:Olfr535 UTSW 7 140493136 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGACCCAATACTTTCCATGACG -3'
(R):5'- ATGGCCACATAGCGGTCATAG -3'

Sequencing Primer
(F):5'- TTGAGTCCCAACCAGACAGTAGTG -3'
(R):5'- CGGTCATAGGCCATAACTGTG -3'
Posted On2015-02-05