Incidental Mutation 'R3125:Icam5'
ID264243
Institutional Source Beutler Lab
Gene Symbol Icam5
Ensembl Gene ENSMUSG00000032174
Gene Nameintercellular adhesion molecule 5, telencephalin
SynonymsTlcn, TLN, Icam3, CD50
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21032073-21039036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21036658 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 617 (I617M)
Ref Sequence ENSEMBL: ENSMUSP00000019616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019616]
Predicted Effect probably benign
Transcript: ENSMUST00000019616
AA Change: I617M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174
AA Change: I617M

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216917
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Icam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Icam5 APN 9 21036795 critical splice donor site probably null
IGL00972:Icam5 APN 9 21034697 missense probably damaging 0.99
IGL01690:Icam5 APN 9 21034799 missense possibly damaging 0.69
IGL02334:Icam5 APN 9 21035209 missense possibly damaging 0.92
IGL03387:Icam5 APN 9 21033801 missense probably benign 0.10
H8562:Icam5 UTSW 9 21035146 missense probably benign 0.04
R0002:Icam5 UTSW 9 21033505 missense probably benign 0.00
R0594:Icam5 UTSW 9 21035598 missense probably benign 0.11
R0605:Icam5 UTSW 9 21032197 missense probably benign 0.23
R1485:Icam5 UTSW 9 21036406 missense probably benign 0.34
R1773:Icam5 UTSW 9 21033525 missense possibly damaging 0.67
R1934:Icam5 UTSW 9 21034786 missense probably benign 0.32
R4117:Icam5 UTSW 9 21037590 missense probably damaging 0.99
R4132:Icam5 UTSW 9 21036657 missense probably benign
R4250:Icam5 UTSW 9 21037739 missense probably damaging 0.98
R4470:Icam5 UTSW 9 21035506 nonsense probably null
R4471:Icam5 UTSW 9 21035506 nonsense probably null
R4826:Icam5 UTSW 9 21037803 missense possibly damaging 0.67
R5182:Icam5 UTSW 9 21034810 missense probably benign
R5586:Icam5 UTSW 9 21034820 missense probably damaging 0.98
R6200:Icam5 UTSW 9 21038749 missense probably damaging 1.00
R6240:Icam5 UTSW 9 21033158 missense possibly damaging 0.80
R6291:Icam5 UTSW 9 21036921 missense probably benign 0.07
R7229:Icam5 UTSW 9 21037001 missense possibly damaging 0.79
R7395:Icam5 UTSW 9 21035442 missense possibly damaging 0.77
R7414:Icam5 UTSW 9 21037593 missense probably damaging 0.98
R7423:Icam5 UTSW 9 21036905 missense probably benign
R8032:Icam5 UTSW 9 21033218 missense probably benign 0.35
R8286:Icam5 UTSW 9 21035526 missense possibly damaging 0.71
Z1177:Icam5 UTSW 9 21035548 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATCAACGCCAGAGGATCAGC -3'
(R):5'- ATCAGCCACCATAAGGAGGG -3'

Sequencing Primer
(F):5'- TGACTGCAGAGAAGTCCGCAC -3'
(R):5'- CCACCATAAGGAGGGACGTC -3'
Posted On2015-02-05