Mutagenetix > Incidental Mutation

Incidental Mutation 'R3125:Slc6a18'

264258

Institutional Source

Beutler Lab

Gene Symbol

Slc6a18

Ensembl Gene

ENSMUSG00000021612

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 18

Synonyms

Xtrp2, D630001K16Rik, XT2

MMRRC Submission

040598-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3125 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73661752-73678023 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73677802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 43 (F43S)

Ref Sequence

ENSEMBL: ENSMUSP00000152146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000221026] [ENSMUST00000221987] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]

AlphaFold

O88576

Predicted Effect

probably benign
Transcript: ENSMUST00000022048

SMART Domains

Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565

Domain	Start	End	E-Value	Type
Pfam:SNF	32	608	2.3e-180	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000022105
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: F43S

Domain	Start	End	E-Value	Type
Pfam:SNF	17	593	2.1e-182	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109679
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: F43S

Domain	Start	End	E-Value	Type
Pfam:SNF	17	511	6.8e-164	PFAM
low complexity region	513	526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109680
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: F43S

Domain	Start	End	E-Value	Type
Pfam:SNF	17	325	2.1e-126	PFAM
Pfam:SNF	392	555	9.1e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132085

Predicted Effect

probably damaging
Transcript: ENSMUST00000220650
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221026
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221987
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222029
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223026
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223074
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9052

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	T	6: 116,427,137		probably null	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Cep135	T	C	5: 76,621,363		probably null	Het
Cfap206	T	A	4: 34,716,310	H385L	possibly damaging	Het
Dach2	T	C	X: 113,819,967	I417T	possibly damaging	Het
Dhx32	T	C	7: 133,725,356	Y332C	probably damaging	Het
Dlx1	T	A	2: 71,532,396	W216R	probably damaging	Het
Dna2	G	A	10: 62,949,202	A33T	possibly damaging	Het
Doxl2	A	T	6: 48,975,371	I77F	probably damaging	Het
Dyrk1a	G	A	16: 94,668,801		probably benign	Het
Fam227b	T	C	2: 126,124,086	T140A	probably benign	Het
Fem1b	T	C	9: 62,796,554	I475V	probably benign	Het
Fign	T	A	2: 63,978,700	Q742L	possibly damaging	Het
Hip1r	A	G	5: 124,000,141	D766G	probably benign	Het
Hsd17b12	C	T	2: 94,033,958	R268Q	probably benign	Het
Htt	T	C	5: 34,804,531	S287P	probably benign	Het
Icam5	A	G	9: 21,036,658	I617M	probably benign	Het
Ifi27l2b	T	C	12: 103,451,335	T198A	unknown	Het
Ip6k3	T	C	17: 27,157,542	Y65C	probably damaging	Het
Kif15	A	C	9: 122,987,961	Q542P	probably damaging	Het
Kit	C	T	5: 75,647,828	A744V	probably null	Het
Kit	G	T	5: 75,647,827	A744S	probably benign	Het
Lonp1	A	G	17: 56,626,488	I129T	possibly damaging	Het
Ltbp4	C	T	7: 27,327,778	R389Q	possibly damaging	Het
Map3k21	A	T	8: 125,941,854	K726N	probably benign	Het
Mcpt8	A	T	14: 56,083,941	I22K	probably damaging	Het
Npb	G	A	11: 120,608,902	V103I	possibly damaging	Het
Olfr131	G	A	17: 38,082,012		probably null	Het
Olfr535	T	C	7: 140,492,851	M71T	probably benign	Het
Pet2	A	T	X: 89,404,721	Y601N	probably benign	Het
Plin2	G	T	4: 86,657,144	Y389*	probably null	Het
Pnpla6	G	T	8: 3,534,670	G763C	probably null	Het
Pnpla7	A	G	2: 25,042,138	D935G	probably damaging	Het
Prr29	A	G	11: 106,374,885	S10G	probably benign	Het
Pthlh	A	T	6: 147,263,291	V27E	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Serpina12	G	A	12: 104,037,983	T130I	probably benign	Het
Stx6	C	T	1: 155,158,908	P6S	probably damaging	Het
Togaram1	G	T	12: 64,966,344	R123L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim9	C	T	12: 70,248,393	G648R	probably damaging	Het
Trpm2	T	A	10: 77,911,374	N1430I	probably damaging	Het
Trpm6	C	G	19: 18,854,431	H1553Q	probably benign	Het
Vav3	G	A	3: 109,628,168		probably null	Het
Zfp574	G	T	7: 25,081,601	A683S	possibly damaging	Het

Other mutations in Slc6a18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Slc6a18	APN	13	73671719	missense	possibly damaging	0.82
IGL01370:Slc6a18	APN	13	73667031	missense	probably damaging	1.00
IGL01959:Slc6a18	APN	13	73677865	missense	probably damaging	1.00
IGL02096:Slc6a18	APN	13	73672751	missense	probably benign	0.05
IGL02147:Slc6a18	APN	13	73668162	missense	probably damaging	0.97
IGL02167:Slc6a18	APN	13	73666472	critical splice acceptor site	probably null
IGL02465:Slc6a18	APN	13	73677785	missense	probably benign	0.11
IGL02548:Slc6a18	APN	13	73669995	missense	probably damaging	1.00
IGL02720:Slc6a18	APN	13	73669968	missense	probably benign	0.16
IGL03341:Slc6a18	APN	13	73677923	missense	probably benign	0.07
R0011:Slc6a18	UTSW	13	73665619	missense	possibly damaging	0.59
R0219:Slc6a18	UTSW	13	73674632	splice site	probably null
R0884:Slc6a18	UTSW	13	73667037	missense	probably damaging	1.00
R1019:Slc6a18	UTSW	13	73677879	missense	probably damaging	1.00
R1610:Slc6a18	UTSW	13	73668225	missense	probably benign	0.10
R1901:Slc6a18	UTSW	13	73670043	missense	probably benign	0.39
R1969:Slc6a18	UTSW	13	73664189	missense	possibly damaging	0.66
R2014:Slc6a18	UTSW	13	73675725	missense	probably benign	0.02
R2445:Slc6a18	UTSW	13	73666752	nonsense	probably null
R2504:Slc6a18	UTSW	13	73675806	missense	probably benign	0.01
R4084:Slc6a18	UTSW	13	73667029	missense	probably benign	0.39
R4571:Slc6a18	UTSW	13	73666370	missense	possibly damaging	0.59
R4735:Slc6a18	UTSW	13	73666435	missense	probably benign	0.42
R5032:Slc6a18	UTSW	13	73666323	missense	probably damaging	1.00
R5859:Slc6a18	UTSW	13	73668159	missense	probably benign	0.01
R6258:Slc6a18	UTSW	13	73670045	nonsense	probably null
R6350:Slc6a18	UTSW	13	73677925	missense	possibly damaging	0.80
R6370:Slc6a18	UTSW	13	73668159	missense	probably benign	0.21
R6640:Slc6a18	UTSW	13	73664282	missense	possibly damaging	0.95
R6747:Slc6a18	UTSW	13	73677991	start gained	probably benign
R7267:Slc6a18	UTSW	13	73671636	missense	probably damaging	1.00
R7702:Slc6a18	UTSW	13	73672796	missense	probably damaging	1.00
R8039:Slc6a18	UTSW	13	73665626	missense	probably benign	0.39
R8423:Slc6a18	UTSW	13	73665574	missense	probably benign	0.00
R8669:Slc6a18	UTSW	13	73664311	missense	probably benign	0.01
R8825:Slc6a18	UTSW	13	73665632	missense	probably null	0.01
R8993:Slc6a18	UTSW	13	73668271	missense	probably benign	0.01
R9023:Slc6a18	UTSW	13	73675770	missense	probably damaging	1.00
R9031:Slc6a18	UTSW	13	73671703	missense	possibly damaging	0.56
R9589:Slc6a18	UTSW	13	73668204	missense	possibly damaging	0.66
Z1177:Slc6a18	UTSW	13	73677860	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AACCCAGACGATTGGAGACC -3'
(R):5'- GACTGCTTCAGCTTCCTCAGAG -3'

Sequencing Primer
(F):5'- TTGGAGACCAGGATGGGACTC -3'
(R):5'- CTAGTGTGCTGCAAAGTGTCCAC -3'

Posted On

2015-02-05