Incidental Mutation 'R3125:Slc6a18'
ID264258
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 18
SynonymsXtrp2, D630001K16Rik, XT2
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73661752-73678023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73677802 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 43 (F43S)
Ref Sequence ENSEMBL: ENSMUSP00000152146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000221026] [ENSMUST00000221987] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]
Predicted Effect probably benign
Transcript: ENSMUST00000022048
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000022105
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: F43S

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109679
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: F43S

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109680
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: F43S

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132085
Predicted Effect probably damaging
Transcript: ENSMUST00000220650
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221026
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221987
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222029
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223026
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223074
AA Change: F43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73671719 missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73667031 missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73677865 missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73672751 missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73668162 missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73666472 critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73677785 missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73669995 missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73669968 missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73677923 missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73665619 missense possibly damaging 0.59
R0219:Slc6a18 UTSW 13 73674632 splice site probably null
R0884:Slc6a18 UTSW 13 73667037 missense probably damaging 1.00
R1019:Slc6a18 UTSW 13 73677879 missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73668225 missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73670043 missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73664189 missense possibly damaging 0.66
R2014:Slc6a18 UTSW 13 73675725 missense probably benign 0.02
R2445:Slc6a18 UTSW 13 73666752 nonsense probably null
R2504:Slc6a18 UTSW 13 73675806 missense probably benign 0.01
R4084:Slc6a18 UTSW 13 73667029 missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73666370 missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73666435 missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73666323 missense probably damaging 1.00
R5859:Slc6a18 UTSW 13 73668159 missense probably benign 0.01
R6258:Slc6a18 UTSW 13 73670045 nonsense probably null
R6350:Slc6a18 UTSW 13 73677925 missense possibly damaging 0.80
R6370:Slc6a18 UTSW 13 73668159 missense probably benign 0.21
R6640:Slc6a18 UTSW 13 73664282 missense possibly damaging 0.95
R6747:Slc6a18 UTSW 13 73677991 start gained probably benign
R7267:Slc6a18 UTSW 13 73671636 missense probably damaging 1.00
R7702:Slc6a18 UTSW 13 73672796 missense probably damaging 1.00
R8039:Slc6a18 UTSW 13 73665626 missense probably benign 0.39
Z1177:Slc6a18 UTSW 13 73677860 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACCCAGACGATTGGAGACC -3'
(R):5'- GACTGCTTCAGCTTCCTCAGAG -3'

Sequencing Primer
(F):5'- TTGGAGACCAGGATGGGACTC -3'
(R):5'- CTAGTGTGCTGCAAAGTGTCCAC -3'
Posted On2015-02-05