Incidental Mutation 'R3125:Mcpt8'
ID264259
Institutional Source Beutler Lab
Gene Symbol Mcpt8
Ensembl Gene ENSMUSG00000022157
Gene Namemast cell protease 8
SynonymsMMCP-8
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56082166-56085273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56083941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 22 (I22K)
Ref Sequence ENSEMBL: ENSMUSP00000015594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015594] [ENSMUST00000225107]
Predicted Effect probably damaging
Transcript: ENSMUST00000015594
AA Change: I22K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015594
Gene: ENSMUSG00000022157
AA Change: I22K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 237 1.65e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184701
Predicted Effect possibly damaging
Transcript: ENSMUST00000225107
AA Change: I22K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in mutation that allows diphtheria toxin-mediated basophil depletion before the second tick infestation exhibit loss of acquired tick resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Mcpt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mcpt8 APN 14 56083945 missense probably damaging 1.00
IGL01960:Mcpt8 APN 14 56082407 splice site probably null
R0973:Mcpt8 UTSW 14 56083800 splice site probably benign
R1472:Mcpt8 UTSW 14 56082334 missense probably benign 0.02
R1908:Mcpt8 UTSW 14 56083834 missense probably benign 0.03
R2131:Mcpt8 UTSW 14 56082283 missense probably damaging 1.00
R3123:Mcpt8 UTSW 14 56083941 missense probably damaging 0.98
R3124:Mcpt8 UTSW 14 56083941 missense probably damaging 0.98
R4209:Mcpt8 UTSW 14 56083918 missense probably damaging 1.00
R4211:Mcpt8 UTSW 14 56083918 missense probably damaging 1.00
R4658:Mcpt8 UTSW 14 56083828 missense possibly damaging 0.46
R4860:Mcpt8 UTSW 14 56082280 missense probably benign 0.02
R4860:Mcpt8 UTSW 14 56082280 missense probably benign 0.02
R5457:Mcpt8 UTSW 14 56082336 missense probably benign 0.04
R5900:Mcpt8 UTSW 14 56082283 missense probably damaging 1.00
R6334:Mcpt8 UTSW 14 56085147 missense possibly damaging 0.90
R6339:Mcpt8 UTSW 14 56082337 missense probably benign 0.00
R7505:Mcpt8 UTSW 14 56083091 missense probably benign 0.05
Z1177:Mcpt8 UTSW 14 56082336 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGGGACAGCCAGGATCTGTTG -3'
(R):5'- TTTGTGTGATCTCTCGCAGC -3'

Sequencing Primer
(F):5'- TTGGTTAGTCCCAGGCATCAAAG -3'
(R):5'- TGATCTCTCGCAGCACCCAG -3'
Posted On2015-02-05