Incidental Mutation 'R3125:Dyrk1a'
ID264261
Institutional Source Beutler Lab
Gene Symbol Dyrk1a
Ensembl Gene ENSMUSG00000022897
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
SynonymsD16Ertd493e, Mnbh, 2310043O08Rik, D16Ertd272e, Dyrk
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94570010-94695517 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 94668801 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023614] [ENSMUST00000119878] [ENSMUST00000122284] [ENSMUST00000139250] [ENSMUST00000155791]
Predicted Effect probably benign
Transcript: ENSMUST00000023614
SMART Domains Protein: ENSMUSP00000023614
Gene: ENSMUSG00000022897

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119878
SMART Domains Protein: ENSMUSP00000113660
Gene: ENSMUSG00000022897

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122284
SMART Domains Protein: ENSMUSP00000112853
Gene: ENSMUSG00000022897

DomainStartEndE-ValueType
low complexity region 127 138 N/A INTRINSIC
S_TKc 150 470 6.63e-79 SMART
low complexity region 493 516 N/A INTRINSIC
low complexity region 590 611 N/A INTRINSIC
low complexity region 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134383
Predicted Effect probably benign
Transcript: ENSMUST00000139250
Predicted Effect probably benign
Transcript: ENSMUST00000155791
SMART Domains Protein: ENSMUSP00000119669
Gene: ENSMUSG00000022897

DomainStartEndE-ValueType
PDB:3ANR|D 126 181 6e-21 PDB
SCOP:d1howa_ 147 179 4e-7 SMART
Blast:S_TKc 159 181 5e-6 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted deletion present a general embryonic growth delay and die during midgestation. Heterozygotes display reduced postnatal survival, postnatal growth retardation, microcephaly, behavioral and motor deficits, and altered neocortical pyramidal cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Dyrk1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Dyrk1a APN 16 94685084 missense probably benign 0.21
IGL01599:Dyrk1a APN 16 94691884 missense possibly damaging 0.94
IGL01809:Dyrk1a APN 16 94659617 missense probably benign 0.00
IGL02201:Dyrk1a APN 16 94692149 missense probably benign 0.05
IGL02345:Dyrk1a APN 16 94671362 missense possibly damaging 0.88
IGL02508:Dyrk1a APN 16 94685183 missense probably damaging 0.97
IGL02709:Dyrk1a APN 16 94685243 missense probably benign 0.08
IGL02713:Dyrk1a APN 16 94685345 splice site probably benign
R0414:Dyrk1a UTSW 16 94663842 missense probably damaging 1.00
R2107:Dyrk1a UTSW 16 94686527 missense probably damaging 1.00
R2394:Dyrk1a UTSW 16 94685132 missense probably benign 0.02
R3124:Dyrk1a UTSW 16 94668801 splice site probably benign
R3792:Dyrk1a UTSW 16 94685074 missense probably benign 0.31
R3963:Dyrk1a UTSW 16 94663746 missense probably benign 0.00
R4573:Dyrk1a UTSW 16 94692023 missense possibly damaging 0.90
R4652:Dyrk1a UTSW 16 94692065 missense probably benign 0.02
R4965:Dyrk1a UTSW 16 94691995 nonsense probably null
R5326:Dyrk1a UTSW 16 94686581 missense probably damaging 0.98
R5540:Dyrk1a UTSW 16 94685343 critical splice donor site probably null
R5593:Dyrk1a UTSW 16 94659583 missense possibly damaging 0.64
R6313:Dyrk1a UTSW 16 94659514 missense probably damaging 0.99
R6396:Dyrk1a UTSW 16 94671440 missense probably damaging 1.00
R6524:Dyrk1a UTSW 16 94685120 missense probably benign 0.02
R7036:Dyrk1a UTSW 16 94686568 missense probably benign 0.09
R7326:Dyrk1a UTSW 16 94692043 missense probably damaging 0.97
R7861:Dyrk1a UTSW 16 94691716 nonsense probably null
R7944:Dyrk1a UTSW 16 94691716 nonsense probably null
R8310:Dyrk1a UTSW 16 94691791 missense probably benign 0.02
RF010:Dyrk1a UTSW 16 94677563 missense probably benign
Z1176:Dyrk1a UTSW 16 94691762 missense probably benign 0.06
Z1177:Dyrk1a UTSW 16 94691580 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCGAGGGAAGAAAACAGTTTCC -3'
(R):5'- ATCGTGATGAGCCCTTACCTATG -3'

Sequencing Primer
(F):5'- GAGGGAAGAAAACAGTTTCCATTTTG -3'
(R):5'- GTGATGAGCCCTTACCTATGTAGTAC -3'
Posted On2015-02-05