Incidental Mutation 'R3147:Cc2d2a'
ID 264278
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 040599-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.906) question?
Stock # R3147 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43866497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 769 (I769N)
Ref Sequence ENSEMBL: ENSMUSP00000114349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: I818N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: I818N

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: I769N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: I769N

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127355
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 66,964,984 (GRCm39) D12G probably benign Het
Alg2 A T 4: 47,472,259 (GRCm39) V183D probably damaging Het
Amy1 T C 3: 113,363,697 (GRCm39) probably benign Het
Asb15 G T 6: 24,566,258 (GRCm39) A404S probably damaging Het
Atf2 T C 2: 73,681,283 (GRCm39) probably null Het
Atosa A G 9: 74,916,120 (GRCm39) I240V probably benign Het
Baalc A T 15: 38,812,568 (GRCm39) E106V possibly damaging Het
Catsperd G T 17: 56,971,039 (GRCm39) C701F possibly damaging Het
Ccdc158 T C 5: 92,805,822 (GRCm39) N311S probably damaging Het
Dbx1 C A 7: 49,286,297 (GRCm39) R56L probably damaging Het
Eif4enif1 T A 11: 3,194,003 (GRCm39) probably null Het
Elmod3 T G 6: 72,563,485 (GRCm39) T48P probably benign Het
Erbb2 T C 11: 98,324,865 (GRCm39) S820P probably damaging Het
Gimap8 T C 6: 48,627,440 (GRCm39) V138A probably damaging Het
H1f5 T C 13: 21,964,285 (GRCm39) probably benign Het
Il6ra G T 3: 89,793,235 (GRCm39) P305Q probably benign Het
Kcng3 A G 17: 83,895,749 (GRCm39) V239A possibly damaging Het
Kcnrg T C 14: 61,845,140 (GRCm39) F60S probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lama1 A G 17: 68,044,653 (GRCm39) D184G probably damaging Het
Lhcgr A T 17: 89,065,771 (GRCm39) L206Q probably damaging Het
Lhx3 T C 2: 26,091,277 (GRCm39) D344G probably benign Het
Marf1 A G 16: 13,943,843 (GRCm39) V1380A possibly damaging Het
Mtcl2 T G 2: 156,862,284 (GRCm39) K1548N possibly damaging Het
Mtfr1 T C 3: 19,271,374 (GRCm39) V182A probably benign Het
Or14a259 A G 7: 86,013,092 (GRCm39) L151S probably benign Het
Or5p64 C T 7: 107,854,883 (GRCm39) G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,229,115 (GRCm39) probably benign Het
Snx4 A C 16: 33,108,094 (GRCm39) D296A probably benign Het
Sox7 A T 14: 64,186,083 (GRCm39) Y373F probably damaging Het
Tuba1b T C 15: 98,830,386 (GRCm39) T145A probably benign Het
Usp32 T A 11: 84,919,913 (GRCm39) N718I probably damaging Het
Wapl G A 14: 34,447,106 (GRCm39) V648M probably damaging Het
Zfp85 C T 13: 67,900,612 (GRCm39) V10M probably damaging Het
Zgrf1 A G 3: 127,377,797 (GRCm39) N1014S possibly damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0193:Cc2d2a UTSW 5 43,893,460 (GRCm39) missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43,894,854 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43,892,737 (GRCm39) missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43,887,317 (GRCm39) missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43,826,015 (GRCm39) missense probably benign
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43,838,673 (GRCm39) missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43,869,781 (GRCm39) missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAGCATGCACTCTCACC -3'
(R):5'- CAGCCCGTGTCTCTAATATAGTCAC -3'

Sequencing Primer
(F):5'- AGGTTCCATCTCTACTATCTGCAC -3'
(R):5'- CGTGTCTCTAATATAGTCACCAGTTC -3'
Posted On 2015-02-05