Incidental Mutation 'R3147:Gimap8'
ID264282
Institutional Source Beutler Lab
Gene Symbol Gimap8
Ensembl Gene ENSMUSG00000064262
Gene NameGTPase, IMAP family member 8
SynonymsIAN9, LOC243374
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48647234-48660875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48650506 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 138 (V138A)
Ref Sequence ENSEMBL: ENSMUSP00000077350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078223] [ENSMUST00000203083] [ENSMUST00000203509]
Predicted Effect probably damaging
Transcript: ENSMUST00000078223
AA Change: V138A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077350
Gene: ENSMUSG00000064262
AA Change: V138A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203083
AA Change: V138A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145286
Gene: ENSMUSG00000064262
AA Change: V138A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203509
AA Change: V138A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145255
Gene: ENSMUSG00000064262
AA Change: V138A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein is larger than the other gene family members and includes three AIG1 domains (corresponding to the AIG1 protein from Arabidopsis thaliana) whereas other family members have one AIG1 domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Gimap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gimap8 APN 6 48658767 missense probably damaging 1.00
IGL02830:Gimap8 APN 6 48656305 missense probably benign 0.01
Kangchenjunga UTSW 6 48659163 missense probably damaging 1.00
lhotse UTSW 6 48658954 missense possibly damaging 0.74
R1224:Gimap8 UTSW 6 48650695 missense probably benign 0.04
R1386:Gimap8 UTSW 6 48656653 missense probably benign 0.04
R1503:Gimap8 UTSW 6 48647529 critical splice donor site probably null
R1560:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R1681:Gimap8 UTSW 6 48656411 missense probably benign 0.01
R2012:Gimap8 UTSW 6 48656353 missense probably damaging 0.98
R2094:Gimap8 UTSW 6 48650568 missense probably benign 0.00
R2937:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R2938:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R4276:Gimap8 UTSW 6 48659083 missense probably benign 0.35
R4281:Gimap8 UTSW 6 48658820 missense probably benign 0.37
R4294:Gimap8 UTSW 6 48658957 missense probably benign 0.00
R4713:Gimap8 UTSW 6 48658986 missense probably benign 0.23
R4750:Gimap8 UTSW 6 48650427 missense probably benign 0.01
R4896:Gimap8 UTSW 6 48659347 missense possibly damaging 0.85
R4936:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R5041:Gimap8 UTSW 6 48659163 missense probably damaging 1.00
R5091:Gimap8 UTSW 6 48656647 missense possibly damaging 0.91
R5215:Gimap8 UTSW 6 48651083 missense possibly damaging 0.88
R5360:Gimap8 UTSW 6 48656302 missense probably damaging 1.00
R6119:Gimap8 UTSW 6 48658954 missense possibly damaging 0.74
R6221:Gimap8 UTSW 6 48658942 missense probably damaging 1.00
R6450:Gimap8 UTSW 6 48656451 missense probably benign 0.03
R7137:Gimap8 UTSW 6 48650253 missense probably damaging 0.99
R7154:Gimap8 UTSW 6 48656188 missense probably damaging 1.00
R7666:Gimap8 UTSW 6 48659155 missense probably damaging 1.00
R7686:Gimap8 UTSW 6 48656072 missense probably damaging 0.99
R7912:Gimap8 UTSW 6 48651065 missense probably benign 0.09
R7993:Gimap8 UTSW 6 48651065 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CGTGTTCGAGTCCAAGTTCAG -3'
(R):5'- ACAACATCGTCGACTTCCAATG -3'

Sequencing Primer
(F):5'- GTTCGAGTCCAAGTTCAGTGATCAC -3'
(R):5'- ATCGTCGACTTCCAATGTTTTTAATC -3'
Posted On2015-02-05