Incidental Mutation 'R3147:Elmod3'
ID264283
Institutional Source Beutler Lab
Gene Symbol Elmod3
Ensembl Gene ENSMUSG00000056698
Gene NameELMO/CED-12 domain containing 3
SynonymsELMOD3, RBM29, Rbed1, C330008I15Rik
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72565922-72598413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72586502 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 48 (T48P)
Ref Sequence ENSEMBL: ENSMUSP00000145544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070990] [ENSMUST00000114069] [ENSMUST00000141833] [ENSMUST00000148108] [ENSMUST00000152705]
Predicted Effect probably benign
Transcript: ENSMUST00000070990
AA Change: T48P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000067768
Gene: ENSMUSG00000056698
AA Change: T48P

DomainStartEndE-ValueType
Pfam:ELMO_CED12 151 314 3.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114069
AA Change: T48P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109703
Gene: ENSMUSG00000056698
AA Change: T48P

DomainStartEndE-ValueType
Pfam:ELMO_CED12 154 313 1.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140825
Predicted Effect probably benign
Transcript: ENSMUST00000141833
AA Change: T48P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000148108
AA Change: T12P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000152705
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility family of GTPase-activating proteins that regulate Arf GTPase proteins. Members of this family are defined by a conserved engulfment and cell motility domain. In rat cochlea, the encoded protein is found in stereocilia, kinocilia and cuticular plate of developing hair cells suggesting a function for this protein in cochlear sensory cells. An allelic variant of this family has been associated with autosomal recessive nonsyndromic deafness-88 in humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Elmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Elmod3 APN 6 72586507 missense possibly damaging 0.66
IGL02725:Elmod3 APN 6 72594775 missense probably damaging 0.96
IGL03089:Elmod3 APN 6 72569316 missense probably damaging 1.00
R0092:Elmod3 UTSW 6 72566809 missense probably benign
R0173:Elmod3 UTSW 6 72577588 missense probably damaging 1.00
R0925:Elmod3 UTSW 6 72568938 missense probably damaging 1.00
R1602:Elmod3 UTSW 6 72569259 critical splice donor site probably null
R5594:Elmod3 UTSW 6 72594816 unclassified probably benign
R5870:Elmod3 UTSW 6 72594738 critical splice donor site probably null
R6045:Elmod3 UTSW 6 72568868 missense probably benign
R7173:Elmod3 UTSW 6 72577252 critical splice donor site probably null
R7229:Elmod3 UTSW 6 72594753 missense probably benign 0.09
Z1177:Elmod3 UTSW 6 72566689 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACCTACAGAATTCTGAAAGAGAGTG -3'
(R):5'- TATGCACTGGGCTCTGAGTC -3'

Sequencing Primer
(F):5'- TTCTGAAAGAGAGTGCGAGAGC -3'
(R):5'- TCTTCTGAGAACACCCAAGGTTG -3'
Posted On2015-02-05