Incidental Mutation 'R3147:Dbx1'
ID264285
Institutional Source Beutler Lab
Gene Symbol Dbx1
Ensembl Gene ENSMUSG00000030507
Gene Namedeveloping brain homeobox 1
SynonymsDbx, Mmox C
MMRRC Submission 040599-MU
Accession Numbers

Genbank: NM_001005232; MGI: 94867

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location49631499-49636849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49636549 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 56 (R56L)
Ref Sequence ENSEMBL: ENSMUSP00000032717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032717]
Predicted Effect probably damaging
Transcript: ENSMUST00000032717
AA Change: R56L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032717
Gene: ENSMUSG00000030507
AA Change: R56L

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
HOX 181 243 1.45e-23 SMART
low complexity region 299 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene die at birth. V0 interneurons develop as V1 or dl6 interneurons. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(6)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Dbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dbx1 APN 7 49636474 missense probably benign 0.22
IGL02795:Dbx1 APN 7 49636577 missense probably benign 0.03
R0630:Dbx1 UTSW 7 49632696 missense probably damaging 1.00
R3104:Dbx1 UTSW 7 49636669 missense probably damaging 1.00
R4002:Dbx1 UTSW 7 49636517 missense probably benign 0.01
R5035:Dbx1 UTSW 7 49632536 missense unknown
R5077:Dbx1 UTSW 7 49633494 missense probably damaging 1.00
R5689:Dbx1 UTSW 7 49632771 missense probably damaging 1.00
R8054:Dbx1 UTSW 7 49632750 missense probably damaging 1.00
X0066:Dbx1 UTSW 7 49632491 missense unknown
Predicted Primers PCR Primer
(F):5'- GCACGGCTGTATCTTACCTC -3'
(R):5'- AAAGGGAGCTACTGCCAGAC -3'

Sequencing Primer
(F):5'- GGAAAGGATGGCATTCACCCC -3'
(R):5'- AGACCCGCTCTAACCATGATGTTC -3'
Posted On2015-02-05