Incidental Mutation 'R3147:Olfr305'
ID264286
Institutional Source Beutler Lab
Gene Symbol Olfr305
Ensembl Gene ENSMUSG00000055571
Gene Nameolfactory receptor 305
SynonymsMOR219-2, GA_x6K02T2NHDJ-9744055-9745014
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86360854-86366928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86363884 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 151 (L151S)
Ref Sequence ENSEMBL: ENSMUSP00000149883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]
Predicted Effect probably benign
Transcript: ENSMUST00000069236
AA Change: L151S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571
AA Change: L151S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-40 PFAM
Pfam:7tm_1 39 288 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213255
AA Change: L151S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000213869
AA Change: L151S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216700
AA Change: L151S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Olfr305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr305 APN 7 86363560 missense possibly damaging 0.46
IGL02102:Olfr305 APN 7 86363866 missense probably benign 0.25
IGL02424:Olfr305 APN 7 86363480 missense probably benign 0.02
IGL02664:Olfr305 APN 7 86363603 missense possibly damaging 0.94
IGL03167:Olfr305 APN 7 86363920 missense probably damaging 1.00
R0035:Olfr305 UTSW 7 86364187 missense possibly damaging 0.95
R0373:Olfr305 UTSW 7 86363805 nonsense probably null
R0510:Olfr305 UTSW 7 86363827 missense probably benign 0.21
R2214:Olfr305 UTSW 7 86364206 missense probably benign 0.01
R3623:Olfr305 UTSW 7 86364100 missense probably benign 0.02
R4155:Olfr305 UTSW 7 86364062 missense probably benign 0.00
R4332:Olfr305 UTSW 7 86363872 missense probably benign 0.01
R4785:Olfr305 UTSW 7 86363735 missense probably damaging 1.00
R4834:Olfr305 UTSW 7 86363744 missense probably benign 0.21
R4871:Olfr305 UTSW 7 86363484 missense probably damaging 1.00
R5161:Olfr305 UTSW 7 86364338 unclassified probably null
R5254:Olfr305 UTSW 7 86364190 missense possibly damaging 0.82
R6430:Olfr305 UTSW 7 86363973 nonsense probably null
R7734:Olfr305 UTSW 7 86364268 missense not run
RF010:Olfr305 UTSW 7 86363386 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTAGGAATCTTCAACACAGTGGAG -3'
(R):5'- CCATACTTGGATGTGCATTTCAG -3'

Sequencing Primer
(F):5'- TCTTCAACACAGTGGAGAAAATG -3'
(R):5'- GCATTTCAGGTATTTTTCATGGCTC -3'
Posted On2015-02-05