Incidental Mutation 'R3147:Eif4enif1'
ID264291
Institutional Source Beutler Lab
Gene Symbol Eif4enif1
Ensembl Gene ENSMUSG00000020454
Gene Nameeukaryotic translation initiation factor 4E nuclear import factor 1
SynonymsD11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3202392-3244588 bp(+) (GRCm38)
Type of Mutationunclassified (4544 bp from exon)
DNA Base Change (assembly) T to A at 3244003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]
Predicted Effect probably damaging
Transcript: ENSMUST00000020734
AA Change: W932R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: W932R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110048
AA Change: W932R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: W932R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110049
AA Change: W956R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: W956R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 712 2.7e-184 PFAM
low complexity region 859 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120721
AA Change: W781R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454
AA Change: W781R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 99 3.6e-29 PFAM
Pfam:EIF4E-T 98 327 5.1e-41 PFAM
Pfam:EIF4E-T 282 537 7.7e-30 PFAM
low complexity region 684 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127950
Predicted Effect probably null
Transcript: ENSMUST00000135223
SMART Domains Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 1 239 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147534
Predicted Effect probably benign
Transcript: ENSMUST00000159304
SMART Domains Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

DomainStartEndE-ValueType
Pfam:TGS 13 58 5.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179770
AA Change: W956R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: W956R

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 710 4.3e-160 PFAM
low complexity region 859 875 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Eif4enif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Eif4enif1 APN 11 3221143 missense probably damaging 0.96
IGL02237:Eif4enif1 APN 11 3227876 nonsense probably null
IGL02372:Eif4enif1 APN 11 3229986 missense probably benign 0.09
PIT4283001:Eif4enif1 UTSW 11 3234464 missense probably damaging 1.00
R0079:Eif4enif1 UTSW 11 3242676 nonsense probably null
R1177:Eif4enif1 UTSW 11 3229902 missense probably damaging 1.00
R1220:Eif4enif1 UTSW 11 3239493 splice site probably benign
R1511:Eif4enif1 UTSW 11 3236278 missense probably benign 0.00
R1675:Eif4enif1 UTSW 11 3215686 missense probably benign 0.02
R1908:Eif4enif1 UTSW 11 3227455 missense probably damaging 1.00
R1940:Eif4enif1 UTSW 11 3243279 missense probably damaging 1.00
R2173:Eif4enif1 UTSW 11 3242367 splice site probably null
R2215:Eif4enif1 UTSW 11 3227476 missense probably damaging 1.00
R2517:Eif4enif1 UTSW 11 3221168 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2873:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R4195:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4196:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4708:Eif4enif1 UTSW 11 3220323 missense probably damaging 1.00
R4755:Eif4enif1 UTSW 11 3244016 missense probably damaging 1.00
R5310:Eif4enif1 UTSW 11 3242687 missense probably damaging 1.00
R5546:Eif4enif1 UTSW 11 3243989 missense probably damaging 0.99
R5816:Eif4enif1 UTSW 11 3242401 missense probably benign 0.13
R6018:Eif4enif1 UTSW 11 3242481 missense probably damaging 0.97
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6267:Eif4enif1 UTSW 11 3227793 missense probably damaging 1.00
R6514:Eif4enif1 UTSW 11 3240996 missense probably null 0.01
R6638:Eif4enif1 UTSW 11 3242463 missense probably damaging 0.96
R7040:Eif4enif1 UTSW 11 3234040 missense probably benign 0.33
R7232:Eif4enif1 UTSW 11 3215678 missense possibly damaging 0.75
R7385:Eif4enif1 UTSW 11 3220269 missense probably damaging 1.00
R7478:Eif4enif1 UTSW 11 3227709 nonsense probably null
R7749:Eif4enif1 UTSW 11 3242608 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCTACTTTGCTGCACTG -3'
(R):5'- TGTGGATCCCCTAAACATCTTCAC -3'

Sequencing Primer
(F):5'- ACTTTGCTGCACTGACACTC -3'
(R):5'- GTGTGCTCCAATGTAAAAGCC -3'
Posted On2015-02-05