Incidental Mutation 'R3147:Erbb2'
ID264293
Institutional Source Beutler Lab
Gene Symbol Erbb2
Ensembl Gene ENSMUSG00000062312
Gene Nameerb-b2 receptor tyrosine kinase 2
Synonymsc-erbB2, c-neu, HER-2, HER2, Neu, ErbB-2, Neu oncogene
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98412470-98437716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98434039 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 820 (S820P)
Ref Sequence ENSEMBL: ENSMUSP00000053897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002655] [ENSMUST00000058295]
Predicted Effect probably benign
Transcript: ENSMUST00000002655
SMART Domains Protein: ENSMUSP00000002655
Gene: ENSMUSG00000002580

DomainStartEndE-ValueType
Pfam:Rdx 23 96 1.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058295
AA Change: S820P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053897
Gene: ENSMUSG00000062312
AA Change: S820P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Recep_L_domain 52 174 2e-32 PFAM
FU 190 231 1.88e1 SMART
FU 233 276 1.03e-6 SMART
Pfam:Recep_L_domain 367 487 2.3e-23 PFAM
FU 502 551 3.08e-5 SMART
FU 558 607 3.97e-8 SMART
transmembrane domain 654 676 N/A INTRINSIC
TyrKc 721 977 1.28e-126 SMART
low complexity region 1040 1080 N/A INTRINSIC
low complexity region 1148 1163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154452
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit degeneration of motor nerves, an absence of Schwann cells, impairment of junctional folds at the neuromuscular synapse, and cardiac defects that results in lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Erbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Erbb2 APN 11 98435630 missense probably damaging 1.00
IGL01460:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01483:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01514:Erbb2 APN 11 98432919 missense possibly damaging 0.94
IGL01520:Erbb2 APN 11 98434009 missense probably benign 0.05
IGL03007:Erbb2 APN 11 98428993 splice site probably benign
IGL03367:Erbb2 APN 11 98422875 splice site probably null
Angular UTSW 11 98422770 missense probably damaging 0.98
PIT4544001:Erbb2 UTSW 11 98421039 missense probably benign
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0388:Erbb2 UTSW 11 98427351 missense possibly damaging 0.66
R0602:Erbb2 UTSW 11 98434271 missense probably damaging 1.00
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1500:Erbb2 UTSW 11 98428978 missense probably damaging 1.00
R1651:Erbb2 UTSW 11 98433457 missense probably damaging 1.00
R1748:Erbb2 UTSW 11 98435335 missense probably benign 0.06
R1807:Erbb2 UTSW 11 98428854 missense probably damaging 1.00
R1861:Erbb2 UTSW 11 98412737 critical splice donor site probably null
R1926:Erbb2 UTSW 11 98425164 missense probably benign
R1998:Erbb2 UTSW 11 98428953 missense probably damaging 1.00
R2051:Erbb2 UTSW 11 98420172 missense probably damaging 1.00
R4022:Erbb2 UTSW 11 98435297 missense probably benign 0.09
R4238:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4239:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4240:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4633:Erbb2 UTSW 11 98432988 missense possibly damaging 0.91
R4725:Erbb2 UTSW 11 98425144 missense possibly damaging 0.71
R5093:Erbb2 UTSW 11 98427453 missense probably damaging 1.00
R5306:Erbb2 UTSW 11 98428206 missense probably benign 0.44
R5375:Erbb2 UTSW 11 98433412 missense probably damaging 1.00
R5518:Erbb2 UTSW 11 98422770 missense probably damaging 0.98
R5710:Erbb2 UTSW 11 98427080 missense probably damaging 1.00
R5938:Erbb2 UTSW 11 98435571 missense probably damaging 0.99
R6062:Erbb2 UTSW 11 98433249 missense probably damaging 1.00
R6116:Erbb2 UTSW 11 98427399 missense probably damaging 1.00
R6514:Erbb2 UTSW 11 98420146 missense probably benign 0.03
R6556:Erbb2 UTSW 11 98436082 missense possibly damaging 0.92
R6570:Erbb2 UTSW 11 98423047 missense possibly damaging 0.88
R6578:Erbb2 UTSW 11 98428188 missense probably damaging 1.00
R7141:Erbb2 UTSW 11 98427309 missense probably damaging 1.00
R7686:Erbb2 UTSW 11 98435573 missense probably benign
X0028:Erbb2 UTSW 11 98434301 missense probably damaging 1.00
X0062:Erbb2 UTSW 11 98423120 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTTGATGGTTTCCTGTATCCC -3'
(R):5'- TGTGAACAAGCCGAACTTCC -3'

Sequencing Primer
(F):5'- CTCTGTTCCCTTGTCTGCAGG -3'
(R):5'- GGTAGCTCATCCCCTGGACAAAG -3'
Posted On2015-02-05