Incidental Mutation 'R3147:Hist1h1b'
ID264294
Institutional Source Beutler Lab
Gene Symbol Hist1h1b
Ensembl Gene ENSMUSG00000058773
Gene Namehistone cluster 1, H1b
SynonymsH1.5, H1B, H1f5, H1s-3
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21779883-21780625 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 21780115 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080511] [ENSMUST00000189457]
Predicted Effect unknown
Transcript: ENSMUST00000080511
AA Change: K147R
SMART Domains Protein: ENSMUSP00000079356
Gene: ENSMUSG00000058773
AA Change: K147R

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
H15 34 99 5.02e-24 SMART
low complexity region 116 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189457
SMART Domains Protein: ENSMUSP00000139663
Gene: ENSMUSG00000101972

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Hist1h1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03026:Hist1h1b APN 13 21779947 unclassified probably benign
R1104:Hist1h1b UTSW 13 21780281 missense possibly damaging 0.66
R1295:Hist1h1b UTSW 13 21779999 missense probably benign 0.23
R3120:Hist1h1b UTSW 13 21780045 missense probably benign 0.23
R4222:Hist1h1b UTSW 13 21779977 unclassified probably benign
R4597:Hist1h1b UTSW 13 21780511 missense probably damaging 0.96
R6289:Hist1h1b UTSW 13 21780439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGCGGTCTTAGGCTTGGTAAC -3'
(R):5'- CAACAGCCGCATCAAGCTTG -3'

Sequencing Primer
(F):5'- AACCTTAGGTTTGGATGCCTTAGAC -3'
(R):5'- GCTCAAGAGTCTGGTGAGC -3'
Posted On2015-02-05