Incidental Mutation 'R3147:Zfp85'
ID264295
Institutional Source Beutler Lab
Gene Symbol Zfp85
Ensembl Gene ENSMUSG00000058331
Gene Namezinc finger protein 85
SynonymsZfp71, Zfp85-rs1, KRAB19
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67747800-67755228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67752493 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 10 (V10M)
Ref Sequence ENSEMBL: ENSMUSP00000121202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091520] [ENSMUST00000144183]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000049518
Predicted Effect unknown
Transcript: ENSMUST00000091520
AA Change: M25I
SMART Domains Protein: ENSMUSP00000089105
Gene: ENSMUSG00000058331
AA Change: M25I

DomainStartEndE-ValueType
KRAB 5 65 5.78e-29 SMART
ZnF_C2H2 81 103 1.95e-3 SMART
ZnF_C2H2 109 131 1.22e-4 SMART
ZnF_C2H2 137 159 6.32e-3 SMART
ZnF_C2H2 165 187 2.95e-3 SMART
ZnF_C2H2 193 215 3.89e-3 SMART
ZnF_C2H2 221 243 3.89e-3 SMART
ZnF_C2H2 249 271 1.1e-2 SMART
ZnF_C2H2 277 299 2.91e-2 SMART
ZnF_C2H2 305 327 2.49e-1 SMART
ZnF_C2H2 333 355 2.09e-3 SMART
ZnF_C2H2 361 383 4.17e-3 SMART
ZnF_C2H2 389 411 2.95e-3 SMART
ZnF_C2H2 417 439 1.3e-4 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143812
Predicted Effect probably damaging
Transcript: ENSMUST00000144183
AA Change: V10M

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121202
Gene: ENSMUSG00000058331
AA Change: V10M

DomainStartEndE-ValueType
KRAB 45 105 5.78e-29 SMART
ZnF_C2H2 121 143 1.95e-3 SMART
ZnF_C2H2 149 171 1.22e-4 SMART
ZnF_C2H2 177 199 6.32e-3 SMART
ZnF_C2H2 205 227 2.95e-3 SMART
ZnF_C2H2 233 255 3.89e-3 SMART
ZnF_C2H2 261 283 3.89e-3 SMART
ZnF_C2H2 289 311 1.1e-2 SMART
ZnF_C2H2 317 339 2.91e-2 SMART
ZnF_C2H2 345 367 2.49e-1 SMART
ZnF_C2H2 373 395 2.09e-3 SMART
ZnF_C2H2 401 423 4.17e-3 SMART
ZnF_C2H2 429 451 2.95e-3 SMART
ZnF_C2H2 457 479 1.3e-4 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181158
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Zfp85
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0383:Zfp85 UTSW 13 67748672 missense probably benign 0.05
R1187:Zfp85 UTSW 13 67749716 missense probably damaging 0.99
R1510:Zfp85 UTSW 13 67754965 intron probably benign
R1775:Zfp85 UTSW 13 67749704 missense probably damaging 0.99
R1803:Zfp85 UTSW 13 67751628 missense probably benign 0.15
R2108:Zfp85 UTSW 13 67748884 missense probably benign 0.08
R2412:Zfp85 UTSW 13 67749646 missense probably damaging 0.99
R4811:Zfp85 UTSW 13 67749626 missense probably damaging 0.97
R5308:Zfp85 UTSW 13 67748855 missense probably damaging 1.00
R5334:Zfp85 UTSW 13 67751684 missense probably damaging 0.99
R5373:Zfp85 UTSW 13 67749458 missense probably damaging 1.00
R7045:Zfp85 UTSW 13 67749593 missense probably benign 0.00
R7391:Zfp85 UTSW 13 67749291 missense probably damaging 1.00
R7438:Zfp85 UTSW 13 67748945 missense probably benign 0.09
R7544:Zfp85 UTSW 13 67749065 missense probably benign 0.02
R8046:Zfp85 UTSW 13 67748979 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAAAGACAGGCAAGCAGTC -3'
(R):5'- ACTTATGTGCAGCGTAGTCC -3'

Sequencing Primer
(F):5'- AGCAGTCCCATGCTGACAGTG -3'
(R):5'- TAACACAGGTGTCTCCAATGGGC -3'
Posted On2015-02-05