Incidental Mutation 'R3147:Kcnrg'
ID264297
Institutional Source Beutler Lab
Gene Symbol Kcnrg
Ensembl Gene ENSMUSG00000046168
Gene Namepotassium channel regulator
SynonymsE030012H22Rik, LOC328424
MMRRC Submission 040599-MU
Accession Numbers

Genbank: NM_001039105, NM_206974; MGI: 2685591

Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61607457-61612826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61607691 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 60 (F60S)
Ref Sequence ENSEMBL: ENSMUSP00000153429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]
Predicted Effect probably benign
Transcript: ENSMUST00000039562
SMART Domains Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051184
AA Change: F60S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168
AA Change: F60S

DomainStartEndE-ValueType
BTB 5 106 8.7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165015
SMART Domains Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183066
Predicted Effect probably damaging
Transcript: ENSMUST00000225582
AA Change: F60S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Kcnrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnrg APN 14 61607910 missense probably damaging 1.00
IGL01311:Kcnrg APN 14 61611825 missense probably damaging 1.00
D4216:Kcnrg UTSW 14 61611793 nonsense probably null
R1081:Kcnrg UTSW 14 61607714 missense possibly damaging 0.87
R1346:Kcnrg UTSW 14 61611695 missense probably benign 0.31
R4690:Kcnrg UTSW 14 61611727 missense probably damaging 1.00
R4820:Kcnrg UTSW 14 61607937 missense probably benign 0.39
R5068:Kcnrg UTSW 14 61607817 missense probably damaging 1.00
R5914:Kcnrg UTSW 14 61611831 missense probably benign
R7234:Kcnrg UTSW 14 61608082 missense unknown
Predicted Primers PCR Primer
(F):5'- CACTAGTGTGAAGCTAGGCAGG -3'
(R):5'- CCAAACACTCTGAAGAAGGCTTG -3'

Sequencing Primer
(F):5'- GCTAGGCAGGATGAGTGGTC -3'
(R):5'- ACTCTGAAGAAGGCTTGAGTATTTTG -3'
Posted On2015-02-05