Incidental Mutation 'R3147:Baalc'
ID264299
Institutional Source Beutler Lab
Gene Symbol Baalc
Ensembl Gene ENSMUSG00000022296
Gene Namebrain and acute leukemia, cytoplasmic
Synonyms
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3147 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location38933144-38952912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38949173 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 106 (E106V)
Ref Sequence ENSEMBL: ENSMUSP00000132788 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000163313
AA Change: E106V

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181362
Predicted Effect possibly damaging
Transcript: ENSMUST00000226440
AA Change: E75V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by gene expression studies in patients with acute myeloid leukemia (AML). The gene is conserved among mammals and is not found in lower organisms. Tissues that express this gene develop from the neuroectoderm. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene; however, some of the transcript variants are found only in AML cell lines. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Baalc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0492:Baalc UTSW 15 38934085 splice site probably benign
R2051:Baalc UTSW 15 38933234 unclassified probably benign
R3148:Baalc UTSW 15 38949173 missense possibly damaging 0.92
R4821:Baalc UTSW 15 38933180 unclassified probably benign
R7807:Baalc UTSW 15 38934017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGGCCTTATATGCATGAG -3'
(R):5'- TGATAAACAGGAAACCGAGATGTTC -3'

Sequencing Primer
(F):5'- ATGCATGAGTCCTTGTAGGTCATTCC -3'
(R):5'- ATGTTCGTCACAGCGTTGG -3'
Posted On2015-02-05