Incidental Mutation 'R3147:Catsperd'
ID264303
Institutional Source Beutler Lab
Gene Symbol Catsperd
Ensembl Gene ENSMUSG00000040828
Gene Namecation channel sperm associated auxiliary subunit delta
Synonyms4933402B14Rik, 4921529N20Rik, Gm6095, Tmem146
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3147 (G1)
Quality Score177
Status Not validated
Chromosome17
Chromosomal Location56628143-56664456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56664039 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 701 (C701F)
Ref Sequence ENSEMBL: ENSMUSP00000108603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112979
AA Change: C701F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828
AA Change: C701F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:CATSPERD 38 766 N/A PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion in this gene display male infertility. Hyperactivity of sperm fails to develop under capacitating conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Amy1 T C 3: 113,570,048 probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Catsperd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Catsperd APN 17 56661271 missense probably damaging 0.98
IGL02598:Catsperd APN 17 56647815 splice site probably null
IGL03037:Catsperd APN 17 56641583 missense possibly damaging 0.80
IGL03330:Catsperd APN 17 56632316 missense possibly damaging 0.45
R0391:Catsperd UTSW 17 56662821 missense probably benign 0.00
R0463:Catsperd UTSW 17 56659554 missense probably damaging 0.99
R0506:Catsperd UTSW 17 56658078 missense possibly damaging 0.95
R0538:Catsperd UTSW 17 56662828 missense probably benign 0.00
R0550:Catsperd UTSW 17 56663427 critical splice donor site probably null
R1503:Catsperd UTSW 17 56654525 missense possibly damaging 0.63
R1705:Catsperd UTSW 17 56633521 missense probably damaging 0.97
R1919:Catsperd UTSW 17 56635548 missense probably damaging 0.99
R2851:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R2852:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R3148:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R4084:Catsperd UTSW 17 56654453 missense probably benign 0.14
R4329:Catsperd UTSW 17 56654517 missense possibly damaging 0.80
R4940:Catsperd UTSW 17 56662736 missense possibly damaging 0.95
R4944:Catsperd UTSW 17 56662744 missense probably damaging 0.97
R4952:Catsperd UTSW 17 56632303 missense probably damaging 0.99
R5079:Catsperd UTSW 17 56658153 critical splice donor site probably null
R5259:Catsperd UTSW 17 56660235 missense possibly damaging 0.93
R5635:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R5929:Catsperd UTSW 17 56652493 missense probably benign 0.00
R6789:Catsperd UTSW 17 56654426 splice site probably null
R6909:Catsperd UTSW 17 56650781 missense probably damaging 0.96
R6920:Catsperd UTSW 17 56655175 nonsense probably null
R7099:Catsperd UTSW 17 56628811 intron probably null
R7106:Catsperd UTSW 17 56658070 splice site probably null
R7371:Catsperd UTSW 17 56650801 missense probably benign 0.22
R7405:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R7478:Catsperd UTSW 17 56664055 missense probably benign 0.00
R7781:Catsperd UTSW 17 56664072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCTTGGGAAAGCTGAAGACC -3'
(R):5'- CAGAAACCCAGAAGTCGCTG -3'

Sequencing Primer
(F):5'- AGACCTGTTAAGAGCATTTTTCTCTC -3'
(R):5'- AGAAGTCGCTGGCCTTTC -3'
Posted On2015-02-05