Incidental Mutation 'R3148:Pam'
ID264310
Institutional Source Beutler Lab
Gene Symbol Pam
Ensembl Gene ENSMUSG00000026335
Gene Namepeptidylglycine alpha-amidating monooxygenase
SynonymsPHM
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location97795114-98095646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97895678 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 256 (N256I)
Ref Sequence ENSEMBL: ENSMUSP00000095228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058762] [ENSMUST00000097625] [ENSMUST00000161567]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058762
AA Change: N256I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057112
Gene: ENSMUSG00000026335
AA Change: N256I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 62 178 7.8e-27 PFAM
Pfam:Cu2_monoox_C 199 346 6.2e-47 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.7e-8 PFAM
Pfam:NHL 782 809 2.8e-7 PFAM
transmembrane domain 870 892 N/A INTRINSIC
low complexity region 908 930 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097625
AA Change: N256I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095228
Gene: ENSMUSG00000026335
AA Change: N256I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.7e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.4e-54 PFAM
Pfam:NHL 581 608 9.4e-9 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.2e-8 PFAM
Pfam:NHL 782 809 3.6e-8 PFAM
transmembrane domain 869 891 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159841
SMART Domains Protein: ENSMUSP00000124479
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
Pfam:Cu2_monoox_C 1 53 4.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161567
AA Change: N256I

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125418
Gene: ENSMUSG00000026335
AA Change: N256I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.2e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.2e-54 PFAM
Pfam:NHL 475 502 8.3e-9 PFAM
Pfam:NHL 527 556 1.9e-8 PFAM
low complexity region 567 574 N/A INTRINSIC
Pfam:NHL 580 608 1.9e-8 PFAM
Pfam:NHL 676 703 3.2e-8 PFAM
transmembrane domain 764 786 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 844 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development, edema, abnormal yolk sac vasculature, thin arterial walls, and abnormal bronchial epithelial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Pam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pam APN 1 97924427 splice site probably benign
IGL00485:Pam APN 1 97822953 missense possibly damaging 0.78
IGL00597:Pam APN 1 97834444 missense probably benign 0.02
IGL01585:Pam APN 1 97864472 missense probably damaging 0.99
IGL01776:Pam APN 1 97885600 critical splice donor site probably null
IGL01981:Pam APN 1 97834441 missense probably damaging 1.00
IGL02152:Pam APN 1 97840749 missense probably damaging 1.00
IGL02605:Pam APN 1 97840339 missense possibly damaging 0.85
IGL02882:Pam APN 1 97840367 missense probably damaging 1.00
IGL03142:Pam APN 1 97894386 missense probably damaging 1.00
IGL03409:Pam APN 1 97864329 missense probably benign 0.04
R0084:Pam UTSW 1 97896049 missense probably benign 0.01
R0200:Pam UTSW 1 97894401 splice site probably null
R0520:Pam UTSW 1 97884195 missense probably benign 0.00
R0734:Pam UTSW 1 97864362 nonsense probably null
R1881:Pam UTSW 1 97923151 missense probably benign 0.06
R2040:Pam UTSW 1 97864442 missense possibly damaging 0.55
R2106:Pam UTSW 1 97831490 missense probably damaging 1.00
R2913:Pam UTSW 1 97923129 missense probably damaging 1.00
R3618:Pam UTSW 1 97834432 missense probably damaging 1.00
R3619:Pam UTSW 1 97834432 missense probably damaging 1.00
R3847:Pam UTSW 1 97854756 intron probably benign
R3848:Pam UTSW 1 97854756 intron probably benign
R3849:Pam UTSW 1 97854756 intron probably benign
R4128:Pam UTSW 1 97834468 missense probably damaging 0.99
R4231:Pam UTSW 1 97884124 critical splice donor site probably null
R4233:Pam UTSW 1 97864394 missense possibly damaging 0.86
R4404:Pam UTSW 1 97854721 intron probably benign
R4536:Pam UTSW 1 97844699 nonsense probably null
R4738:Pam UTSW 1 97923132 missense probably damaging 1.00
R5054:Pam UTSW 1 97821917 missense probably damaging 1.00
R5501:Pam UTSW 1 97840365 nonsense probably null
R5572:Pam UTSW 1 97854744 intron probably benign
R5654:Pam UTSW 1 97864398 missense probably benign 0.00
R5659:Pam UTSW 1 97842299 missense probably damaging 1.00
R6112:Pam UTSW 1 97834468 missense probably damaging 0.99
R6513:Pam UTSW 1 97838027 missense possibly damaging 0.60
R6696:Pam UTSW 1 97885727 missense possibly damaging 0.79
R6743:Pam UTSW 1 97896049 missense probably benign 0.01
R6833:Pam UTSW 1 97837992 missense probably damaging 0.99
R6834:Pam UTSW 1 97837992 missense probably damaging 0.99
R7098:Pam UTSW 1 97898347 missense probably benign
R7117:Pam UTSW 1 97977116 start gained probably benign
R7152:Pam UTSW 1 97885740 missense probably damaging 1.00
R7172:Pam UTSW 1 97834478 missense probably benign 0.10
R7206:Pam UTSW 1 97896032 missense probably damaging 1.00
R7262:Pam UTSW 1 97854723 missense
R7434:Pam UTSW 1 97975790 nonsense probably null
R7466:Pam UTSW 1 97842247 missense probably damaging 1.00
R7513:Pam UTSW 1 97853185 missense possibly damaging 0.88
R7790:Pam UTSW 1 97821847 missense probably damaging 1.00
R8054:Pam UTSW 1 97840389 missense probably damaging 1.00
R8093:Pam UTSW 1 97885632 missense probably damaging 1.00
R8183:Pam UTSW 1 97834474 missense probably benign 0.08
R8404:Pam UTSW 1 97895633 missense probably damaging 1.00
Z1176:Pam UTSW 1 97934723 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTGCCACCATATCGAGAG -3'
(R):5'- CGAATTCCTTGAACTCTTATGATGC -3'

Sequencing Primer
(F):5'- TCGAGAGAACCGATGAAGTATTAAAC -3'
(R):5'- GATGCTTCATTAAGATAGGCAACAG -3'
Posted On2015-02-05