Incidental Mutation 'R3148:Serpinb5'
ID264311
Institutional Source Beutler Lab
Gene Symbol Serpinb5
Ensembl Gene ENSMUSG00000067006
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 5
Synonymsovalbumin, 1110036M19Rik, Maspin, Spi7
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106861173-106883348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106881825 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 320 (H320Q)
Ref Sequence ENSEMBL: ENSMUSP00000108350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086701] [ENSMUST00000112729] [ENSMUST00000112730] [ENSMUST00000188745]
Predicted Effect probably damaging
Transcript: ENSMUST00000086701
AA Change: H320Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083908
Gene: ENSMUSG00000067006
AA Change: H320Q

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112729
AA Change: H320Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108349
Gene: ENSMUSG00000067006
AA Change: H320Q

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112730
AA Change: H320Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108350
Gene: ENSMUSG00000067006
AA Change: H320Q

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188745
SMART Domains Protein: ENSMUSP00000140264
Gene: ENSMUSG00000067006

DomainStartEndE-ValueType
Pfam:Serpin 1 74 1.6e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele displayed peri-implantation lethality with impaired endoderm development and attenuated inner cell mass growth. Mice homozygous for another null allele were viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Serpinb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Serpinb5 APN 1 106880326 missense probably benign 0.01
R1385:Serpinb5 UTSW 1 106876123 missense probably damaging 1.00
R1480:Serpinb5 UTSW 1 106881707 missense probably benign
R1497:Serpinb5 UTSW 1 106876052 missense probably benign 0.08
R1503:Serpinb5 UTSW 1 106870289 missense possibly damaging 0.76
R1933:Serpinb5 UTSW 1 106876121 missense probably damaging 0.99
R2400:Serpinb5 UTSW 1 106881952 missense probably damaging 0.98
R2567:Serpinb5 UTSW 1 106875146 missense probably benign 0.33
R2923:Serpinb5 UTSW 1 106876040 missense probably benign
R3820:Serpinb5 UTSW 1 106875072 nonsense probably null
R4667:Serpinb5 UTSW 1 106872295 missense probably benign 0.00
R4814:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4815:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4816:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4817:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R5369:Serpinb5 UTSW 1 106881757 missense possibly damaging 0.85
R6108:Serpinb5 UTSW 1 106881728 missense probably damaging 1.00
R6222:Serpinb5 UTSW 1 106870340 missense probably benign 0.09
R6251:Serpinb5 UTSW 1 106875065 missense possibly damaging 0.96
R6349:Serpinb5 UTSW 1 106881765 missense probably benign 0.44
R6936:Serpinb5 UTSW 1 106870418 missense probably benign 0.00
R6977:Serpinb5 UTSW 1 106872347 missense probably benign 0.20
R7332:Serpinb5 UTSW 1 106872361 missense probably benign 0.00
R7369:Serpinb5 UTSW 1 106875149 missense probably benign 0.29
R7443:Serpinb5 UTSW 1 106881970 missense probably benign 0.00
R7499:Serpinb5 UTSW 1 106872389 critical splice donor site probably null
R7724:Serpinb5 UTSW 1 106875142 missense probably damaging 0.98
R8425:Serpinb5 UTSW 1 106881785 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATTGTTACAGTGGACCAACCC -3'
(R):5'- CAAGTTCCCTGAGACTTGGC -3'

Sequencing Primer
(F):5'- GTTACAGTGGACCAACCCCAGTAC -3'
(R):5'- TTCCCTGAGACTTGGCAAGGC -3'
Posted On2015-02-05