Incidental Mutation 'R3148:Prrx1'
ID264312
Institutional Source Beutler Lab
Gene Symbol Prrx1
Ensembl Gene ENSMUSG00000026586
Gene Namepaired related homeobox 1
SynonymsmHox, mHox, Pmx1, Prx1, A230024N07Rik, K-2
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location163245119-163313710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163257848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 171 (D171G)
Ref Sequence ENSEMBL: ENSMUSP00000075203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027878] [ENSMUST00000075805] [ENSMUST00000174397]
Predicted Effect probably benign
Transcript: ENSMUST00000027878
AA Change: D171G

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027878
Gene: ENSMUSG00000026586
AA Change: D171G

DomainStartEndE-ValueType
HOX 94 156 4.93e-26 SMART
Pfam:OAR 219 236 7.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075805
AA Change: D171G

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075203
Gene: ENSMUSG00000026586
AA Change: D171G

DomainStartEndE-ValueType
HOX 94 156 4.93e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174397
AA Change: D171G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134338
Gene: ENSMUSG00000026586
AA Change: D171G

DomainStartEndE-ValueType
HOX 94 156 4.93e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183691
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription co-activator, enhancing the DNA-binding activity of serum response factor, a protein required for the induction of genes by growth and differentiation factors. The protein regulates muscle creatine kinase, indicating a role in the establishment of diverse mesodermal muscle types. Alternative splicing yields two isoforms that differ in abundance and expression patterns. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal defects affecting mandible, limbs, and vertebrae, vascular abnormalities, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Prrx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Prrx1 APN 1 163261967 missense probably damaging 1.00
IGL01103:Prrx1 APN 1 163261962 missense probably damaging 1.00
R0309:Prrx1 UTSW 1 163312559 missense possibly damaging 0.62
R0620:Prrx1 UTSW 1 163257816 missense probably damaging 1.00
R0624:Prrx1 UTSW 1 163248405 unclassified probably benign
R1728:Prrx1 UTSW 1 163261967 missense probably damaging 1.00
R1784:Prrx1 UTSW 1 163261967 missense probably damaging 1.00
R2497:Prrx1 UTSW 1 163248265 missense possibly damaging 0.94
R3729:Prrx1 UTSW 1 163261877 missense probably damaging 1.00
R4667:Prrx1 UTSW 1 163254047 missense probably benign 0.18
R4730:Prrx1 UTSW 1 163312613 missense probably benign
R4768:Prrx1 UTSW 1 163257765 missense probably damaging 1.00
R5222:Prrx1 UTSW 1 163261973 missense probably damaging 1.00
R5448:Prrx1 UTSW 1 163248298 missense probably damaging 0.99
R7034:Prrx1 UTSW 1 163248338 missense probably benign 0.37
R7036:Prrx1 UTSW 1 163248338 missense probably benign 0.37
R7529:Prrx1 UTSW 1 163253964 splice site probably null
R8020:Prrx1 UTSW 1 163248262 missense probably damaging 0.97
Z1088:Prrx1 UTSW 1 163261877 missense probably damaging 1.00
Z1177:Prrx1 UTSW 1 163312465 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGCAAAAGCAGCCTTGAGAG -3'
(R):5'- GGAAGGGGTCTAGACTCATCTTG -3'

Sequencing Primer
(F):5'- AGCAGCCTTGAGAGTGGTG -3'
(R):5'- GGGTCTAGACTCATCTTGTATTTTTC -3'
Posted On2015-02-05