Mutagenetix > Incidental Mutations

Incidental Mutation 'R3148:Olfr1280'

264313

Institutional Source

Beutler Lab

Gene Symbol

Olfr1280

Ensembl Gene

ENSMUSG00000109449

Gene Name

olfactory receptor 1280

Synonyms

MOR248-1, GA_x6K02T2Q125-72366920-72367837

MMRRC Submission

040600-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R3148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111314017-111326003 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111316288 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 270 (F270L)

Ref Sequence

ENSEMBL: ENSMUSP00000151980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000213551] [ENSMUST00000219291]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082167
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: F270L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	305	3.8e-50	PFAM
Pfam:7tm_1	41	287	9.9e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090328
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: F270L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	3.6e-49	PFAM
Pfam:7tm_1	41	287	3.9e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204064
AA Change: F270L

SMART Domains

Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: F270L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	298	2.1e-39	PFAM
Pfam:7tm_1	40	286	7.8e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213551
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219291
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	C	X: 67,921,378	D12G	probably benign	Het
Adamts18	C	A	8: 113,738,858	V701L	probably damaging	Het
Alg2	A	T	4: 47,472,259	V183D	probably damaging	Het
Ank2	T	C	3: 126,933,075	I857V	probably benign	Het
Asb15	G	T	6: 24,566,259	A404S	probably damaging	Het
Baalc	A	T	15: 38,949,173	E106V	possibly damaging	Het
Catsperd	G	T	17: 56,664,039	C701F	possibly damaging	Het
Cc2d2a	T	A	5: 43,709,155	I769N	probably damaging	Het
Cntnap4	A	G	8: 112,757,439	T375A	probably damaging	Het
Col7a1	A	G	9: 108,961,405	T974A	unknown	Het
Ehbp1	T	C	11: 22,100,465	Y502C	probably damaging	Het
Gm13083	A	T	4: 143,617,477	D449V	probably benign	Het
Kcnj11	C	T	7: 46,099,120	V260I	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Marf1	A	G	16: 14,125,979	V1380A	possibly damaging	Het
Otog	T	C	7: 46,290,169	L2124P	probably damaging	Het
Pam	T	A	1: 97,895,678	N256I	possibly damaging	Het
Pcbp1	C	T	6: 86,525,489	E143K	probably damaging	Het
Prrx1	T	C	1: 163,257,848	D171G	probably benign	Het
Rasal2	A	T	1: 157,243,764		probably benign	Het
Serpinb5	T	A	1: 106,881,825	H320Q	probably damaging	Het
Snx4	A	C	16: 33,287,724	D296A	probably benign	Het
Sorcs2	T	C	5: 36,035,788	Q778R	probably benign	Het
Spata16	T	C	3: 26,878,712		probably null	Het
Tcerg1l	G	T	7: 138,259,867	Q378K	probably benign	Het
Trpm1	T	C	7: 64,235,012	Y814H	probably benign	Het

Other mutations in Olfr1280

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Olfr1280	APN	2	111315670	missense	probably damaging	1.00
IGL01906:Olfr1280	APN	2	111315901	missense	probably damaging	1.00
R0078:Olfr1280	UTSW	2	111315904	missense	probably benign	0.04
R0091:Olfr1280	UTSW	2	111316173	missense	probably benign	0.00
R0295:Olfr1280	UTSW	2	111316154	missense	probably damaging	0.99
R1650:Olfr1280	UTSW	2	111316295	missense	probably benign	0.04
R1808:Olfr1280	UTSW	2	111315998	missense	probably benign	0.00
R2120:Olfr1280	UTSW	2	111315499	missense	probably benign	0.02
R3084:Olfr1280	UTSW	2	111316116	missense	probably benign	0.36
R3085:Olfr1280	UTSW	2	111316116	missense	probably benign	0.36
R3086:Olfr1280	UTSW	2	111316116	missense	probably benign	0.36
R4229:Olfr1280	UTSW	2	111316336	missense	probably damaging	1.00
R4258:Olfr1280	UTSW	2	111315638	missense	probably benign
R4908:Olfr1280	UTSW	2	111316229	missense	probably benign	0.09
R4972:Olfr1280	UTSW	2	111315818	missense	probably damaging	1.00
R5051:Olfr1280	UTSW	2	111316254	nonsense	probably null
R5551:Olfr1280	UTSW	2	111315571	missense	possibly damaging	0.52
R7573:Olfr1280	UTSW	2	111315932	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGGTGTCTTAGCAACAACTTGTTTC -3'
(R):5'- CAGGTAGTGTGTAGTCAATTGAAG -3'

Sequencing Primer
(F):5'- TCAAAGGCGCTCTCTACA -3'
(R):5'- TCACAATGTTCTAATCTTCAGACAC -3'

Posted On

2015-02-05