Incidental Mutation 'R3148:Olfr1280'
ID264313
Institutional Source Beutler Lab
Gene Symbol Olfr1280
Ensembl Gene ENSMUSG00000109449
Gene Nameolfactory receptor 1280
SynonymsMOR248-1, GA_x6K02T2Q125-72366920-72367837
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111314017-111326003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111316288 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 270 (F270L)
Ref Sequence ENSEMBL: ENSMUSP00000151980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000213551] [ENSMUST00000219291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082167
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: F270L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.8e-50 PFAM
Pfam:7tm_1 41 287 9.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090328
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: F270L

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204064
AA Change: F270L
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: F270L

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213551
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219291
AA Change: F270L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Olfr1280
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Olfr1280 APN 2 111315670 missense probably damaging 1.00
IGL01906:Olfr1280 APN 2 111315901 missense probably damaging 1.00
R0078:Olfr1280 UTSW 2 111315904 missense probably benign 0.04
R0091:Olfr1280 UTSW 2 111316173 missense probably benign 0.00
R0295:Olfr1280 UTSW 2 111316154 missense probably damaging 0.99
R1650:Olfr1280 UTSW 2 111316295 missense probably benign 0.04
R1808:Olfr1280 UTSW 2 111315998 missense probably benign 0.00
R2120:Olfr1280 UTSW 2 111315499 missense probably benign 0.02
R3084:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3085:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3086:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R4229:Olfr1280 UTSW 2 111316336 missense probably damaging 1.00
R4258:Olfr1280 UTSW 2 111315638 missense probably benign
R4908:Olfr1280 UTSW 2 111316229 missense probably benign 0.09
R4972:Olfr1280 UTSW 2 111315818 missense probably damaging 1.00
R5051:Olfr1280 UTSW 2 111316254 nonsense probably null
R5551:Olfr1280 UTSW 2 111315571 missense possibly damaging 0.52
R7573:Olfr1280 UTSW 2 111315932 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGTGTCTTAGCAACAACTTGTTTC -3'
(R):5'- CAGGTAGTGTGTAGTCAATTGAAG -3'

Sequencing Primer
(F):5'- TCAAAGGCGCTCTCTACA -3'
(R):5'- TCACAATGTTCTAATCTTCAGACAC -3'
Posted On2015-02-05