Incidental Mutation 'R3148:Spata16'
ID264314
Institutional Source Beutler Lab
Gene Symbol Spata16
Ensembl Gene ENSMUSG00000039335
Gene Namespermatogenesis associated 16
Synonymsspermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location26637620-26983212 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 26878712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]
Predicted Effect probably null
Transcript: ENSMUST00000047005
SMART Domains Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 5 569 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108305
SMART Domains Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 1 534 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Spata16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Spata16 APN 3 26924262 missense probably damaging 0.98
IGL01017:Spata16 APN 3 26840722 missense possibly damaging 0.93
IGL01129:Spata16 APN 3 26913184 splice site probably benign
IGL01330:Spata16 APN 3 26914715 missense probably damaging 0.99
IGL02033:Spata16 APN 3 26913334 critical splice donor site probably null
IGL02069:Spata16 APN 3 26732795 nonsense probably null
IGL02231:Spata16 APN 3 26913264 missense probably damaging 1.00
R0084:Spata16 UTSW 3 26667410 missense possibly damaging 0.95
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0325:Spata16 UTSW 3 26667456 missense probably damaging 0.98
R0811:Spata16 UTSW 3 26913338 splice site probably benign
R2061:Spata16 UTSW 3 26924370 missense probably damaging 0.99
R4837:Spata16 UTSW 3 26732932 missense possibly damaging 0.93
R4972:Spata16 UTSW 3 26840723 missense possibly damaging 0.93
R5129:Spata16 UTSW 3 26667564 missense probably damaging 0.98
R5235:Spata16 UTSW 3 26667632 missense probably benign 0.00
R5458:Spata16 UTSW 3 26777537 missense probably damaging 0.99
R6578:Spata16 UTSW 3 26667548 nonsense probably null
R7069:Spata16 UTSW 3 26927334 missense probably damaging 0.99
R7256:Spata16 UTSW 3 26667867 missense probably benign 0.25
R8015:Spata16 UTSW 3 26667659 missense probably benign
R8060:Spata16 UTSW 3 26840720 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTGCTATGCTATTACTGCTGC -3'
(R):5'- AAGCCTAAAATTGTGAGCACAC -3'

Sequencing Primer
(F):5'- CTATGCTATTACTGCTGCTAAGTG -3'
(R):5'- GTGAGCACACAAGGCATATTG -3'
Posted On2015-02-05