Mutagenetix > Incidental Mutations

Incidental Mutation 'R3148:Spata16'

264314

Institutional Source

Beutler Lab

Gene Symbol

Spata16

Ensembl Gene

ENSMUSG00000039335

Gene Name

spermatogenesis associated 16

Synonyms

spermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12

MMRRC Submission

040600-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R3148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26637620-26983212 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 26878712 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]

Predicted Effect

probably null
Transcript: ENSMUST00000047005

SMART Domains

Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335

Domain	Start	End	E-Value	Type
Pfam:NYD-SP12_N	5	569	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108305

SMART Domains

Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335

Domain	Start	End	E-Value	Type
Pfam:NYD-SP12_N	1	534	N/A	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	C	X: 67,921,378	D12G	probably benign	Het
Adamts18	C	A	8: 113,738,858	V701L	probably damaging	Het
Alg2	A	T	4: 47,472,259	V183D	probably damaging	Het
Ank2	T	C	3: 126,933,075	I857V	probably benign	Het
Asb15	G	T	6: 24,566,259	A404S	probably damaging	Het
Baalc	A	T	15: 38,949,173	E106V	possibly damaging	Het
Catsperd	G	T	17: 56,664,039	C701F	possibly damaging	Het
Cc2d2a	T	A	5: 43,709,155	I769N	probably damaging	Het
Cntnap4	A	G	8: 112,757,439	T375A	probably damaging	Het
Col7a1	A	G	9: 108,961,405	T974A	unknown	Het
Ehbp1	T	C	11: 22,100,465	Y502C	probably damaging	Het
Gm13083	A	T	4: 143,617,477	D449V	probably benign	Het
Kcnj11	C	T	7: 46,099,120	V260I	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Marf1	A	G	16: 14,125,979	V1380A	possibly damaging	Het
Olfr1280	T	C	2: 111,316,288	F270L	possibly damaging	Het
Otog	T	C	7: 46,290,169	L2124P	probably damaging	Het
Pam	T	A	1: 97,895,678	N256I	possibly damaging	Het
Pcbp1	C	T	6: 86,525,489	E143K	probably damaging	Het
Prrx1	T	C	1: 163,257,848	D171G	probably benign	Het
Rasal2	A	T	1: 157,243,764		probably benign	Het
Serpinb5	T	A	1: 106,881,825	H320Q	probably damaging	Het
Snx4	A	C	16: 33,287,724	D296A	probably benign	Het
Sorcs2	T	C	5: 36,035,788	Q778R	probably benign	Het
Tcerg1l	G	T	7: 138,259,867	Q378K	probably benign	Het
Trpm1	T	C	7: 64,235,012	Y814H	probably benign	Het

Other mutations in Spata16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Spata16	APN	3	26924262	missense	probably damaging	0.98
IGL01017:Spata16	APN	3	26840722	missense	possibly damaging	0.93
IGL01129:Spata16	APN	3	26913184	splice site	probably benign
IGL01330:Spata16	APN	3	26914715	missense	probably damaging	0.99
IGL02033:Spata16	APN	3	26913334	critical splice donor site	probably null
IGL02069:Spata16	APN	3	26732795	nonsense	probably null
IGL02231:Spata16	APN	3	26913264	missense	probably damaging	1.00
R0084:Spata16	UTSW	3	26667410	missense	possibly damaging	0.95
R0109:Spata16	UTSW	3	26913267	missense	probably damaging	0.97
R0109:Spata16	UTSW	3	26913267	missense	probably damaging	0.97
R0325:Spata16	UTSW	3	26667456	missense	probably damaging	0.98
R0811:Spata16	UTSW	3	26913338	splice site	probably benign
R2061:Spata16	UTSW	3	26924370	missense	probably damaging	0.99
R4837:Spata16	UTSW	3	26732932	missense	possibly damaging	0.93
R4972:Spata16	UTSW	3	26840723	missense	possibly damaging	0.93
R5129:Spata16	UTSW	3	26667564	missense	probably damaging	0.98
R5235:Spata16	UTSW	3	26667632	missense	probably benign	0.00
R5458:Spata16	UTSW	3	26777537	missense	probably damaging	0.99
R6578:Spata16	UTSW	3	26667548	nonsense	probably null
R7069:Spata16	UTSW	3	26927334	missense	probably damaging	0.99
R7256:Spata16	UTSW	3	26667867	missense	probably benign	0.25
R7936:Spata16	UTSW	3	26667423	missense	possibly damaging	0.71
R8015:Spata16	UTSW	3	26667659	missense	probably benign
R8060:Spata16	UTSW	3	26840720	missense	probably damaging	0.99
R8161:Spata16	UTSW	3	26840662	missense	probably benign	0.16
R8459:Spata16	UTSW	3	26667527	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGTGCTATGCTATTACTGCTGC -3'
(R):5'- AAGCCTAAAATTGTGAGCACAC -3'

Sequencing Primer
(F):5'- CTATGCTATTACTGCTGCTAAGTG -3'
(R):5'- GTGAGCACACAAGGCATATTG -3'

Posted On

2015-02-05